Description :
From Genome Similarity Track
Location :
Scaffold_9:127443- 129074
Transcript NameFunction/comments
Physo_129761putative polyprotein

Sequence
1631 bases(100 bases per row)
ACGGCAGCCCCGCTGCACTTGGTAGCACTTATAGTCAATCCGACACCTGAGTCTGTATAGACTGACCCTCTGTGGAGAATGGAGCAGTTCGCTCACTTGC
CCCCGAACCAGCAGGATGCGCTTAAAAAGCTTATGCCCTTGCTGGGCCCGGAGGGCGTGACGCAACTTGCGCAGCAAGGCCCCGACGCGGTGAACGCGCG
TCTCGAGGCGTTTTCAAGCTACGAGAATGCTCAACTAGAGCACCTCCAGCAGAGGATGGCGACTGCCGCGGCGCCCCAAGCGCCCCCTTCGTCGTCCGAC
GCGGGAACAAGACCCAAGCCGCTCATGTTGAGCGTGAAGACCTTCGAAGGCAAGGAGGGTGTAAGCTTGATGCTTTGGACCCGTGAGGTTGAGATGGCTA
TGAGCTCAGCTCTACTCCGGATGGAATCACAGCGCGTGGCACTAGCTATCTCGAAGCTCGGTGGGCGAGCGAGAGAGTGGGCACTAACGTCCGGGACGTC
GGTCGAGGTGGCCTTCCCGACGTGGGACCAGCTGAAACAGCAATTGCTCCGAGTGTTCGCTCCGCCTAACGAGGCGTATCGCGTGCGCTCACGCTTCCTG
GCTACTCGTCAGAGCAAGAAGGAGTTGGTGGACTATGTCCAAGAGCTGAGAACTCTCATTGCAGGGATGTCTGCTGACCCGTTGCCGGAAGCAGTCACCG
TCACGGTGTTCATGGAGGGCCTTCGCACTGGCGTTGCCAGGACGGAGGTGTTCCGAACCCACCCGAGCTCTTTTGAAGAGCCTGTGAGCGTCGCATTGAA
TGTGGAACACAACTTTATGTCGTCGAGACTTGGGTGGAATGCGTCTTACGCTAGCGCGTCGAATGGTCCGAACCCATGGACCTCAGCTATACTGAAGACG
AAGAAGATGAGCTTCGTGCTGCGGAGCAGCGTCGCAGTATCCGCAGATGCTTCATCTGTGGTGACACCCGTCACCTTCATGCTGGGTGTCCGCTGCGCCA
TCAGCGCCAGGCTTCGTCAAGCCGCTCTTCGAGTTCAAGCCAGGGCTCTGGTTCGTCTCGGGGAAACGAGAAGTCCCAGTAGGCGCGGGGCGGCCTACTG
GGGAAGAACTAAGTTCTATTGAGCTTCGGTGAGGTGGAGGTCGACAGGACTTAGCCCCGAAGAGAGCTGTACTCTCCAACACGGAACGTGTATGCAAGCC
GGGCTTGCTAGTCGTCCAAGCTTGGGTGAAGGGCTTCACGAAGCCATGAACGATTTTGATCAATTCGGGAGCGTCGGGTACTTACGCCCGGCGTTCTACG
ATGGACGGAAGTCAGATTTATGCTGAGGCCCTGATAGCGCGCGGAAGTGACATCGTCACTGTTCGTCTCGCGACGGGCACTCGTGTCACGGTGCCTAAGG
TCCCTGTGGACCTGGGCATGAAGTTTTTTTGATTTTGATAGCGTGGAACGCTGTCTGGTCTTAGACCTCGATTCGAGATATGATCTCATTCTTGGTATGG
TGTGGCTGGAATGCCACGAGCCTTGGATCGATTGGAGGTCGAACACCCTTGGTGCTACGCACTTCTCTCCTGGCGGAGCGTTGGCGAGTCATGAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGC