Description :
From Genome Similarity Track
Location :
Scaffold_529:12743- 16700
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_529-fgenesh-gene-0.8DNA replication licensing factor MCM5
Pytiw_DAOMBR242034snap_masked-piw_contig_529-abinit-gene-0.27Phosphoglycerate mutase

Sequence
3957 bases(100 bases per row)
AATAACAAGGTCGCAGATCTACTTGACGCGCGAGACGAACTTGTACTGGTTGAGTTGGCGCAGCGAGCCCTTCTGGACCATGGCGCGGATGGCGCGCTGG
ATCGCGTTCGGGTTGTAGCCCTGGGCCTCGAGGCGGCTGTAGAGCGCCGCGGTCTCGACGCGCATGCCGATGCGCAGCGTGCGGTTGATGCTCTGTTCCA
CCTCCTGCGCCTTCTCGTGGAAGCCGCCGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCCTGCGTGCCGCCGTCCTTGGCGGCGTTCATGGTCGAGACGCTGAAGAGCCGCACGGCCTCGCGCACGTGGTCGATCGTGGCCTCGTTCTGG
AGCTTCATCTTGGCAAGCGACTCAGAGATGCGCACGAGCGCCTCGAGCTGTCGCACGGTCACGGGAATCGTCGTCTCGCCGCCCTGGTTCTTGCGCACGT
CGTCGCGCACGCCCACGTAAAAGTCCTGGAGCGCCTGGGCCGCGCCGAGCGACAGCCGCGGCGCGCACCGCGTGCGGCAGTACGTGATGAACTTCTTCAT
GAGCCACGGCTCGTACTCGCCCGTCTTCTCCTCCATGGCCGTCCTGGAGCTGCCGCCCGTGTGAATGCGCACGACGTGGGCCGCCATCTGTCGGTCGCGT
GCATCATCCTGGATGTCGCGCACGATGAAGATCATGTCGAAACGCGAGAGGATCGTGCTCATGAGATCGATGTTCTCGGACGCGCTGCGCATATCGTCGT
AGCGGCCAAAGACCGGGTTCGCGGCCGCGAGCACGGATGCGCGCGAATTGAGGATCGTCGTGATGCCGGCCTTGGCGATCGAGATCGTCTGCTGCTCCAT
GGCCTCGTGGATCGCCACACGATCCGACTCGCGCATCTTGTCGAACTCGTCGATGCACACGACGCCACCGTCCGCGAGCACCATCGCGCCACCCTCGAGG
TAGAACTCGCCCTTGGCGTCCTTGATCACGGACGCCGTGAGCCCCGCCGCGCTGCTGCCCTTGCCGGACGTGTACACGCCCACGGGCGCCACTTTCTCCA
CGAACTTGAGAAACTGACTCTTCGCGGTGGACGGATCGCCCAGCAGCAGCACGTTGATATCGCCACGCAGCTACAATGTAGTGTCCATATCAGCAAACCA
CTGGACAAATTCCAGCCACCCATTTGTTAAAAGTGTCCACTTACAATCATTCCGTCCGGGAGACGCTTGCGAGAGCCGCCCACGAGCAGACACGCGATCG
CTTTCTTTATGTTCGTCGTGTAGTCGCCGTAGATGGATGGCGCGATGCTGGACGAGAGCTTCTCGTACAGATCTGGGTCGCGCGCCATCTCGTGGAACTT
CTCTTCTTCTGCGGGCGAGAACGTCGCCTTCGCACGCCCTGCACCCTCTTCGTCGATCTGATACGATCAGCACCAACACAGTCAGTGAGCATTTCACAAC
CTGTACAAATTCAACGCAAATACAAAGCCGCACCTCAATGCCCACGACGCGAATGTAGAGCGTGCGGATGGCGACGGCGCCGACCTGCTTCGCGCCGGCA
TTGACCACGGACGTGATGCCCACGACCGACACGCGCGTGCCCGGCGACGCCTTGTCGACGAGGTGACGGTCCGCGATGAGCGCCAGATTGCGCGGCATCT
CGCCCGTGGGCACCACCTCAGGGTTCTCCTGGAGCTTGAGCGTCTGCTGGTCGACGTAGTCGCCTCGGTCGGGCAACACGATGTACGAGTCCTTGGGACA
GAGCTCGCCGCCTTGCTCCTCTTCGCGGTTGCGGTCGCACATGCGCGGGATGTTGATACCGCCGAGCCCAGACACGGCCACGCGCTTGGTGTTGCCGCAG
TTCTTGCAGCGGAGCGTCGCCGCCACGCACTTTGTGCGCACGCGCGTGGCGCTGATCACGATCCCCGGCACCTTCACGAGTCGATTGATCTCCTGCGCAT
GCACGGAGCGGAGCGCAGCGGGTGCTTGGTCGCTGGAGATCACGGCTTGGATGTCCGGCAGGTTCTTCACGTTTACGGGCTCGCTGTTCACGGCGCCGTC
GACAGTCGTGGTCTGCTGCTCGCTGCGGTTGAGCACGAGCAGGTACGCGAGCATCTCCTTGGCGGCGTTCTCGAGCAGCGGCAGGTGGTCCTTGGGGTTC
TTGAGCATCAGGTCCTGCAGGAACTGGTCATACGTGGCCAGGTGGCTCAGGCTCACGGTGAAGTAGTAGTTGTTGCGCCGGTAGTTGGCGATGAGCTGCT
CGCGGTAGAAGAAGATCGGCCCCACGCGGAAGCTGCGCAAGAACTCGTGCAACCGCCGCTGGATCGCGATGGGCGACGTATCCTGCGCGTCACGCGCCGC
CACGGCCGACGCGCTCTCCATGCCCATGGACGACACGCGGCCCACATCCCAGTCCATGCTTGAGCTGAGCTGCTGCTGCGCTTTTTGGTGAATTATTTTG
CGCGCGCTTTTTTTGCGGGAAACGATCTCGACATATTCGACAGAAGGTAACGACCCGTGTAAATGAATACACGACATCGTTTTGGACATGTTTGTGCAAT
AAAAGTGGCGAGAATTTATATATCAGCTCAACTAGGTTTCGATAAGATCAAAACCCATACTCAGAGGTTATTTTGTACATTGATCGCATAGATTGATGCA
GTCTAATGCTTTGTATAGAGGTCTATTTCCAATTTATAGAGGCTTAGATCGCATTTACGGGGGATCTGCAGCGGCAGCGACACAGACGCGTCACGCACCT
CATTTCGAGATTTTCCGAGAGCTCCACAAGTCCAAGCAAGCCCAGAAAGAAGACGATGGCTGGTGCGTTGCTCTCTGTGTGTCTGTGTGTGTATGAAGGA
GCGAATGCCACCGCCACCGCATGCTCCTCTTCCCCACGCGCTCGATGGCACGTCTGTTGTTGCACGCAACGGGGAGCGTGAGGCGTCTCTTTGTGCTGCA
CGAGTAGCTCTGAAAACAAATCTTTTTTTTTTTGCACGTGCTCACCTCTGTGTGTGTGTGCTACGAATGGTCTTAATGCAGCCAAGTACCAGATCGTGCT
GATCCGCCACGGCGAGAGCCAGTGGAACGTGGACAACCGCTTCACGGGCTGGGAGGACGTGCCGCTCTCGGCTACGGGCGAGAAGGAGTCGCACGACGCC
GGCAAGGTGCTCCAGGCCGCCGGCTTCAAGTTCGACGTGGCGTTCACGTCCGTGCTCAAGCGCGCGATCAAGACGCTCTGGAACATCCTCGAGGAGACGG
ACCTCATGTGGATCCCCGTGGTGCGCTCCTGGCGCCTGAACGAGCGCCACTACGGCGCGCTCACGGGCCTCAACAAGCAGGAGACCGTCGAGAAACACGG
CCTCGAGCAGGTCATGGTCTGGCGCCGCAGCTACGCGATCCCGCCGCCGCCCCTCGACGCCGCGAGCCCGTACTACCCGGGCAACGACGCCAAGTACCAC
GACGTGCCCAAGGAGCTCCTGCCCTTCGCCGAATCGCTCGCGACCACTGGCGAGCGCGTGCTGCCGTACTGGGAGCAAACGATCATCCCGGCTATCCAGA
GCGGCAAGAAGATCATCATCGCGGCGCATGGCAACAGCCTGCGCGCGCTCGTCAAGCACCTGGACAATATCCCAGAGGACACGATCACGGGCCTTAACAT
CCCCACGGGCGTGCCCCTCGTGTATGACCTGGACGAGAACTTCAAGCCTGTGCCGCACGCCGACGCCATCGCGCCGCTCACCGGCCGCTACGTCGGCAAC
CAGGAGGAAATCAAGGCGCGCATCGCCGGCGTCGCCAACCAGACCAAGGCCCACTAG