Description :
From Genome Similarity Track
Location :
Scaffold_1:1274294- 1275458
Sequence
1164 bases(100 bases per row)
GCTGCTGACGCCCAGCGTATCCCCGACGACACCACCCGCGTGGCTTTCGCGATATCGTACTTGAAGGGTCGTGCGGAAGATTGGGCGTTCTCCAAACTTT
TGACGGACCGCCATTGCTTCTCGTCCTTCGCGGTCTTTGAGACCGAACTAAAGGCAATGTTCCTGCCGCCAAACAGCGATTTTCGTTATCGCTCGCAGTA
TCTGGCATGCAAGCAAGGAAAACGTTCCCTCCAAGAGTTCATCCATGACCTTCGCTTCTTGGCAGCGAATATTAACGATGAAGAATCACTCCCGGAGTCC
CTGCGTGTTACCTTTTTCATGGACGGTCTCAAACAAGGCCCGGCGCGCACCCAGCTTTTTCGCGCCTTCCTGGACATCTTCGAAGAAGCCATCCGAATAG
CGCTTTCGGAATCATGTCTCCATCCTCACCCAGGCATCGAACGACCGCACGTGTTTCAATTGCGGTCGCCCTGGACACTTTTCCCGTGCATGTCTGGCAC
CTCGCCGTGTGGCGGCAGCAGCGCCTAGTGCACACGGTTCCTCCCGTGCCGCGCCAGATACCCACTCGCGTCGTCCTCCGAGCGGTCCACCTAACCACTT
CAATCGCGAACGCCATGGCGCCTCGCGCCCGCCTTTCCGACCCGCTCCAGGCTAGAGTGCGGCGGGAAACGGTCGCTCCCAGTAGGCGCGAGGCGACCTA
CTGGGGACACCCTAGGTCCTTTGAAGGTGTGTGGCGCGCTGACACACTCTCAGGACCTAGCCTCGGACACACACCTTCTTCTGTGTCGTGTTGGGCTCCA
ACCCAACAAAATGATTCGTTTGGAACTTGTCGTACCTGGCTTTCCGACCAGGCTCTCTGCTTTAATCGATTGTGGGGCGTCGAACAACTACGCCAGCCGC
TCCACTCTCACTCGCCTCAACCGCTTACCCCCTTCGGAACCTTCCGACAGGGTTCGCGTCAGGATGGCCGACGGCCACACTGCGTCTCAACCACGCATCA
TCGTCGACGTCACCATCACCTTCGACGGTTTCGACTCGGTTGAACCGTTCTATGTTATCGACCTCGACAAGAGATGGGATCTCATCATCGGGATGTCCTG
GCTGGAGTCCCACCAGCCTTGGATTGATTGGAAGGCAAAATCCGTGCACAAGGTTACTTGGCTT