Description :
From Genome Similarity Track
Location :
Scaffold_3039:1274- 2965
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3039-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
1691 bases(100 bases per row)
AGCTGCTGCACCACGTCCAGCGGCAGTTGAGACGGCATCCCGGACGCCTGCAAGTGTCTCCCCATGATCACGCTCGCCGGGTAATCTGGAAGCGCGTACT
TGAGCAACTCGTTCCCACCACGAGATGTGCGATCTGGAGTCCACGTGGGTTGGTCAATCCACGCGTGCACTTCGCTTCGATACCACGCGTTGAGTTGCTC
GACCCACTCCGTAACGGACTGATAGCGCGTTGAAGGCGCATTGGGGACGCGACCAAGCGAAGACACGCCGCCAGTGTCGCCGGTGGCAGCACCAGAGATA
ATGCCTCCGTGCACAAACAGCGTTTCGTGCGCAGTGAACGCCAGACTGCCCAGCTCCAAGTACTCGCGAAGCACGCCTCCCTCTCGAACGCTATCCAAAT
ACGACTGCAACACGCTCTCGTCGTTCGGCGTCATTACTCGATCATTGGCTCTCGACGCTATTTCCTTGCGTCGTCTCTCGAAATCGCCTTGTGCGCCCAT
CGTGTGCTCCAGCATCCACTTGAGGCGGTTCACCTTCGTGTTTGCTGCGTTTAGCAGCTCGTCGTCAGTTACGAGTCCCTCGTTCGCACTGCTGGGCTCC
TGTTCGCTCTTGATCTGACGCTCAAGGAAGCTCTTGATGGTCACGCGGCGGTCTTTGGGAGCCCAGATGGGCCCTTCATAGATCTCTGGTTGGCAAGAGA
GCCACAACAGAATGTTACGAGGCTGACACACGAGACACAAGCATTAATTGATACGGCACTGCGCTTACCTCTGGCCATCGTATCGAAGTTCATCTCGCTG
TCGTCCAGCTCGGACGTGAAGCGCATCTTGTTCACGTCGCGGTTGCCCACGAGCAGCACCACGCGGTCTGGGTATTTCTTCTTCAGGCGCACCAACTGTT
CGTAGCATCTGCATTGCCAAGCAAGCCAAGAGCAGCATCAACAGCCAAAATAATAATAAGAACACGTCAGGCGCCTACCCACGCATGGTGACTATTCAAA
TACAAACACACGCAAAACGCACTGCAGAGTCTCGCCGCCTTTGTCGCCCGCGTCGCCGCCAAACACGAGCACGCAGTCGTCGTTGAGCTCCAGCTCTTCA
GCTGCCGCCTGCGCTTGCTCCTTGAAGCGCAGACACGTCGACTGACGCACAAAGTTGCGCACGTACGCCCAGTTGCCCTCGACGTCCGTCAGGAAGCACA
CGCGCTGTCGTGACGCTGCGGTCGTAGGCATCGGGCATGTCGTCATTAAGTGCGCGCCCCGCATTACGAGTTCAACCTGCAACAGCAAAATGCAGCATTT
CGACCAATCAAGAAGCTTCATCGAAAATCCGGAGGCCAAACAAAGCATTTTATTTGTAAATAAAAATGCTTTGTTTGGCCTCCGGATTTTTATCACAGGG
AATAAAATTTCAAAATTCCCAACATAGTGAAATCAGGCTGTTTCACGTCACAGATCGCTGGGCTTGAAAATAAGTACGGAAAGGGCACTCCACCGGAGCT
GCACTCAAGGAGCCGCGCCCGAGATGATCCCCGCGAGCTGCTGCACCCGTGGTTGCACGGTCGTTTGCAATGCTACCCCGCGTCGTACAGCTGTGCCGTC
TCCTGATTGATTGCGGCGTTGCTTCACATTTGTACGCGAACGCGACGCACATCCTGCTGAAGGGCGAAACGCAGCCAGTGCTGCTACACCA