Description :
From Genome Similarity Track
Location :
Scaffold_2993:1274- 2275
Transcript NameFunction/comments
Phypl_g15543abc transporter

Sequence
1001 bases(100 bases per row)
CCGTGCGTGCTCAGCTGGAACAACCTCAACTACTCTGTAGCGTGTCCAAAGACGGCCGACGCCCCAgacggcaagaagaccaTCCTGGACCATGTCAGCG
GCCGGTGCGCGCCCGGAGAGCTCACGGCCATCATGGGCCCGTCCGGTTCGGGCAAGACCACGctcgtggacctgctggccgaccgCATCAGCTCCGGGGA
AGTCACGGGCGACATCGAGCTCAACGGCGAGGCCCGCGTGACCAAGACATTCCGCGCCGTGACCAGCTACGTGGCCCAGGAGGACTCGCTTCTCGGCTCC
ttcacggtgctggagaccATGCGCATGGCCGCCAAGCTCAGTCTGCCCAACAGCGTGACGTCCAAGCAGATCGAGgcgcgcgtggacgacgtggtggagg
ccatggGGCTGGCCACGTGCCGCCACACGCTGGTGGGCGACATCTTCCGCAAGGGCCTGTCGGGCGGCCAGAAGCGGCGACTGAgcatcgccatcgagct
gctgtcgaaccCGAGCATTCTCATTCTGGACGAGCCCACCAGCGGCCTggactcgagcgccacgcacAACGTCATGAAGTTCATCGTGAAGCTGTGCGCC
GAGGGCAAGACTGTCGTGtgcacgatccaccagccgtcgtcgctggtctACGACATGTTCACgaacgtggtggtgctgacggcggGCCAGACCGTGTACT
GCGGGCCCCGTCGCCAGATGATCCCGCACTTCGCGGTGGCGGGCCACGACTGCCCGCAGTACATGAACCCGGCCGAGTACTTCATCAGCCTCGTGAACAC
GGACTTTGACGAGCACGCGGACGTGCCCAAGCTCGTGCACTCGTACGCGCAGGGCGAGATCCGCAAGGAGCTGAGCAACCGCATCGAGAGCgaccgcaag
acgctgcagcacctgccgGACATCGagcagccgtcgccgtcggcgctgcggcaGTTCGGCGTGCTCATGTACCGCAACATGCTCAACAACATCCGCAACC
C