Description :
From Genome Similarity Track
Location :
Scaffold_83:127378- 128918
Transcript NameFunction/comments
g2559.t1hypothetical protein

Sequence
1540 bases(100 bases per row)
CTGTACTGACGCCCTCCCTGTTCGTCTCTTCTTCATCTTTTTCACCACTGCCGTGTCCGACGCCACTTGTTGCACTGGAGGTGGCGCCTGACACACAGGA
GGGACCAGTTGCGGCAGCTCGAACGGAATCACACTGATCACCTGACAGCCTCGCTGCACGAAGTCCATGAGCGCCGTCTCCCGTTGGCACACAAACTGCA
GGAACATGTGCTTGAGCAACGCCATGTTCCTCGTGGCCGTGCGGTACTGCAGATAGAGGAAGACGCAGCCGCGGGAGTCGAGTGGCCATTTCGGTTTGGC
GAGCAGGAATTCCGCTTCCTGGCGTCTCCGGGCGCTGGTTCGAAGCACCGGGAAGATGGTGACGATGGTGCAGCCCTGCCGCATCATGGGCACCAAGGTG
TTCTCGTGCTCATTGAGGAAATCGGCGAAGATGCGGCGCAGCATGGACAAGTTCTGCGACTTGAGACGCAGCTCCAGGTAGGCCGTGAAATCCTGCAGCA
TTGCGTGGTCTCGAGGCACCGACGTGGGGGGAGCTCGACCACGACTCACGTACCCGTCAACGGTCTCTACAGAACGTGCACGCGTTGTGTGCCCCGAGGA
ATCGGTGGACGTCGCCATGAGTATCCTGGGAGTGGTTCAGAAATGAGGCGGAGGGATTTGGTGGGGTTGTATGGACTATATAATATGGAGCGGCGTTTGA
CGAAATGCTGTGTGGGACGAGGAACGACGCAGCCTGTTGCTGGAGAGGTCAGAGTCGAGGAATTCGACTGCTCTGGAGCGAGTCCACGATGGAGCAGAGG
ACGCGATGCGATGCTGGGCTCGACGACAGCGCAGTCGCAGCTTGGCACGGTGCGTGACGACTTGTAGCCAGCGACGAAAAGCTCGAGTTTCACGACAGCG
AGTGGCCAAGTGGACAGCAGAAGTGAGTTGACTGGGACCCCCCGTCGTACAGGCAGCTATATAGATAAAAGCGAGTACACGTCTGCAAGACGCTCGCCTT
CGCAGCTTGATGAGCCAGGAGAGCCGCTCGACTGAGCGTCTTCGGACTAACAGGTGAGTTCTCACGAGACCGAAGCTTCAGCGGAGACTGGCGAGTCACA
CGAAGCTTGATGATTGGCTTTCTCGCTCGCAATTGAACTCGACAACCCCCGTGCTCTCGTCCATCCAGCAGCTCCGACGTTAGCATTTTGAGCGCAAGCG
ACTCGCGCTGATACTCTCGCCTCACCGACGTACTCAGTAGCAAAACGTCGCTATTGTAATCACTCACATCTGCTCATCAAAGTCCGAGCAAAAGGCAGCG
CATCTACGAGCACAGGCGTCCGATCCAACTCGCACCGCCGGTTCCAGTCGGCCTTGAGCTCGCACTGAGTCGTTCGAGCTCGAAATTTCACGCCGTCGAT
TCGGGGTTGAACCAGCAGTTGCTTCTCCTCCACACCGCTTTGCAACAGTTTTCCTTTGCAAGAAAAGCTGCTTGGCACGGGCCAGCGCCGGGAACGCCAC
GATGCCCACCATGTCTTCCAGCCGTGTCACTTCAATATGG