Description :
From Genome Similarity Track
Location :
Scaffold_609:12734- 16139
Transcript NameFunction/comments
Phyta_totarag9629hypothetical protein

Sequence
3405 bases(100 bases per row)
GCATTCACCGATCTCCCCTGGTGATCCGCAAATTTTCTTGATCGGAAGATCTGAGGCTCCTTGGTAGCTCCACGGATTCTCCGATGTCGATGTGCGTATC
TTGATCCAACCTCAAGAACCTCGCCTTGTCATTGTGGATCTGTTGTCGTCCACTATGCTGGATCTTCACGTAGTCCGGCAAGTAGACAGATCCATCGGCT
AGATCCAGCCGGATCCCAGCCGGTACCATGAAATCCATGCCTAAAATATTATCTTGGCCTGCCAGATCACCCACCCAGATATCGAAGAAATTAACCAGAG
ATCCTACTAGTGTGATCTTGATTCGGGTCTTGCCATTCATCGTATATGTACTTTCGCCAATCCCCACACAATCTCGGCTCTGACTCGTGTCGACACAGCA
CCCCACCTTACGAGCAAAGGTGGTGTCCACTGTGGACACCTCGGCACCAGTGTCTAAGAGTAAGCTCGTATTTTCATTGTTGATCTTCCCCATCGCTTTC
ACTTGTCTGAACCACTTACCCGGCGCGTGATGTTTCCAATAACCTCTCGACTCTCCcgcgaggagatccagaGACATCATCACGTCGGATCAGCGATATT
CATCTACATGACGAAGGCTTGCAACCATGGCTGTGCGTTTCTCATGCAGATCACATGTATTATCGCGTAGCTGCTGTCCGCTGACTTGATCTaccgactt
cttctccaccaatGCATAAATGCACACCTCAGAACGCTCGGCTCGTATCAGGTTCCAACCTGACGAGTGTCCTAGTTTAACATCTTCTCAGCCATGGCCG
GAAGCATGCCAGCATGTTTGGTCGGATCGTACCACTGCCGGAGTTGGTTGTAAAACTCCTTCATCGGGTATTTTCCCATATCCTGCAATTCTCCACATCC
GCGACACACAAAGAGGTAGTGCTCCGACGGATGACCCTTCTTCCCGCACTTTTGGCAGATcaatcgtctccagcagccgaGATCTGTGTACTTACGAGAT
CCGCAATGTGAACAACGGCTACGGTTTGACCCGTCTTGCTGGATCTGCGATCTGGGTTATCTCCTGACGCTATGAAGATCCGTCGTAAGTCTCCCTCAGA
CTCAGATCTGTACGTTCCAGAGGCAGATCCTGAATTGGAGTCTTGGGTTTAGGTCACTTGGACCGCCCGctttgttggtgctgccgGCGCCGGCGCGACT
ACCTTCTGTCGGTATTTGTTAGATTCAAAGGCTGATTTCTTCAGTCGACTGTTGGCCCTTTCACGGGCGCGTAGGACCTCCTCTAGCTCATCGGCATCTG
CCAGTCGAAGCGACATCAATTGATCGGCCAGATCTTAATCTCCCAGTGTCTCGATGAAATGGTCGACATGTTCTCGGCGTTTCTTCGCTCCACCATCCAT
GGCCTTCAACCGTGCTCGCAAACCAGCTACGTTAAGCCGGTAGGGGTACTCCAGCGGGGTCTCGTCGGATCTCTTGCGCGCATGGTAGTATTGCCTCGCG
ACTGAGACACTGAGACCACAGTACTGGATCTGGAAGCTATGGAGTAGATCGCTCCACTTATTTTGCGTCGTCCGGCTCAACTGGCGGCACCAGTTCCGCG
CAGGCTCCGTCAGCAGATCTCCGAATGTCAAACACTTTTAGGAGGCCTGACCATGCAAGGATGCAGACTTAACCTTGTTGATCCACCCTCTTGCccgatc
tccatcttgatCTTTCCCGGTGAACTCCTTCAGATCCGAGATCGCTGAGATCCGCACATGTTGGATGAGCGCGGATCCAGCTGATCCAGCCGTTGCTGTG
GCACCTGCGGTCCGAGTGGGTGGTGCATCCAGATCGTCGGGATCGTACTCCTAGCGAGCGGGGTGACGGTCGGGCGATCCGAACGACTCCATATCCACGT
CTTGCGTGCCAACGTTCCTTGTAGTGGTCGCGACCGGGGTTGGTGCCGTGATCTGCTGTTCTTTGAGGAATCGGCTCATGGCAGCTTGGAAGTACGATAC
TAGCCTGATTGTTGATTCTTCCGAAGAGGTTACATTTGCGACCTGGTTCGGCTGCCTCTGTTGTTGCGGCAGCATCCGATCCTAGAGCTTCCCACGAAAT
CGCGATCTCAATAGTGCTTCTCCGAAAGGTCCTAGGGGCATGTGTTGCGGCCTTATGGATCCATCGGAGTCCGGTTCTGATGTAGTCGATCCATAATGTG
AAGAGCTAGGCTGGCACTCCGTCGTTCTAATCTGGGGCGAGATCTCTGGAACTTTGATCCGTGCATTTCCGCTTACCAAGATCGCTAGTCTAGCGAATAG
CTTCTGGGAAGTAGATTTGACGGTGTCTAGGTCCAGATCAAACAGTCCGTCCGCGTCGAAAGCGCCGGCAACTAGACCTGCCTCTTTCAGCATCTGGAGT
AGGTTCTTGACCACGGTCAGCTTGCTGGACGTTTCTGGCGGAGCTCACACTGGACCCTTCAGATCTCCGATCTGTTGTACcttcatgatcttcatcACCG
GATCTTGGAGTAAGAAGTTGCGAAGCGCTTTGTGGTGAAACGCGAATTCTAGCTCCTGTTCGGTCCATGCAGATGGAGATTCCTTCTGGTCTTCTCCCTC
CGACTCAGGtgccttcattttcttccgCGTAACCTTCGttttcatcttcttcttcgtatTAGACTTTGCGACTAGCGGGCTTGCGGTCGCTTCGTCCGGT
ACGGTACGGATTTAACCTTACCTGTTTTGTTTTGCGGATCTCGATACGCATCGAGATCCGCTGGGGTCCCCAAAGTGATCTGAGGAGGAGGTTTAGGTTT
CTCTTCTAGATCTGTTACCAGATCTCCCTCATTTCCATCGACAGAGTTCCTCCCAGCACTCTGCCGATCTGCGGATTTTGCTTCATTCAAtggagtcgtc
gtcgatctaATCTCGATAACGCTTGATACCCGTGTTCTTCTTTCACCTTCACATCTTCTTGAGACTCATGGTGAAATCCCGAATAACCAAAAGatccggg
cacgcgcaccattgtggtgtagcgggatccgTCAAAAGCTTACTGAGGCTGGATCCGGTTTTCCAACTTTGCCCAaacaccgactaacggaggggtCCCC
CGATGACCCGTGATCTGCTGAgctggtcaccttgtgtacccgtcggtgggtTGGATCTGCTCTCTTGGTGACTACTGAAGTGTGAGACCGTCAggtcttg
aacgtcttggcgagacCCGGGGATGGGTGGAGCAGCATGGATATCTTCGCTCTGTGTCCGTATGCTTGTACTGATACAAGGGCGATTAAATCATGCTCTG
ATCTGGCGGCTTGGGACTTGACCCGGCTGCAGGGTTGCCTTGGGTGTAGCTTCCTTTCCTTTCTTTGTACTTGCTGCTTCCAATAGCGGGAACTCGATCG
TTGAG