Description :
From Genome Similarity Track
Location :
Scaffold_567:12730- 13977
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_567-fgenesh-gene-0.7Serine protease

Sequence
1247 bases(100 bases per row)
GCTTGCTGCTGATGAAGACTCTATGCGAATAGTTGGCTAGCCGTCTGGCAAGGGACGCAATGAATGCTGGTTGTTTCAGTTGCGAAACGATCTCTCATTC
ATGCACTGCCGTCAGCCAAAACAGAAGAAGCTTGAGCATAATTCTGGAAAACCGATTTCAAGGCTCGGCAGCAAAACTCAAACACAAACTCTTGAAACGG
ACGTCCACCGCACGCGCGCAAACCTTCATGATACGATCTGGGTGGGAGGCTGGGAGACGAAGAATGGCATGGAAGAAAATGGATGAGCTCCGACGAAGTT
TGAGACTATTTAGAAGTTGCTACTTGATGATTATTAACACGACTTACAGACGTAGGCTTTTACAAATGATGAGCCTGTCAATGAAGGTGCTGCTGCACGA
ACTAGGAAGAAAGTGGGTGGTTAATCAAATAGTACTTGCTGGCAAAGTGTTCAGGCTCCTACCACTTGTGGGGCTTGGCCCACGCTCCTCCGGCCGCTGC
CGCATCAGGTGCTGGTGCTGGCACTGGCACTGGTCCTGCTCCGTTCGAGACCGACTGACCTGGTGGTGGTCCCCACGCGTCACCACCCTGGATCGTTGTC
GTGCTACTGCTGACCGTGGTCCTCTTCACCACCGCAGCGCCGTTGCCACCCCACGCGACCGTCGCAGTCGCAGTCGCAGTCGTCGTGGTGGTCGTCGTTC
TGGCCGCACTGGTGGCCTTGAACGTACCAGGTTGCTCGCGAGTACGCTTACCACGAAGCAAAGCCTGGATTTTGATCGCAGCCTGGGCTTCCGTGAGTGG
GAGCGCCTCGGGGAACGCCGTACCAATCTTCACGCGGTCGCCGCGGCCAAAGCTGAAGCACTTGATGTTGGCCAAGTACGGACCGAGCTGGATGACGTTC
TCCTCCTTGCCGTTCAAGAAGCAGAGCGTGTAGAGCGCGAGCTCGAATTCGGGGCTCACGCCGATAAGACTCGTGGATACGGGCTTGATCTCGCGCTCCC
ATCTGAACTGGATCGTCACGAGCTGCTCGTGGTTATACGGCTCCATGAACTTGCGGCCGCGCTGCTTGGGGCGAATGAACCCGCGGTAGTCCAGGCGGCC
GTGGCGCTCTTCGTTGTAGATCTGCATCCAGTTGTGGCAGCCGCACACTTTGCCCTGAACGAAAATGAACAGCAACACTGTAAATAACAGTGTCACATCG
CCCTCTAGAGCACAGTGCTTAGTTCAAGGACGTACATCACGCTCTTC