Description :
From Genome Similarity Track
Location :
Scaffold_3691:1273- 2329
Sequence
1056 bases(100 bases per row)
TCTCAACTTTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATC
CACGATATAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCAT
CCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGAGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGGTGGAGTTTTGGAAGGAACTCTGTCGACGGAAGAGA
GGTAGATCCGGATCCGGACCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCGGATTCACCGGTTAAGCCAACATCGTACCCAAACCCAAGCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAGATGAGTAAGACTACGAGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTGAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAGGATCTATTACG