Description :
From Genome Similarity Track
Location :
Scaffold_118:127249- 129900
Transcript NameFunction/comments
Phyra_72256predicted protein putative
Phyra_84634membrane protein

Sequence
2651 bases(100 bases per row)
GGACGCCTCTTTCTTCTTCTTCTTGTCGCTCTTGGGCGCCCAGCGGTTCGGATCTTTCTCCTTCTTGGGCTTGGCGCCGCCGCTCTTCTCGGCGCGCAGG
GCCTTCTTCATGGCGTTCTTGCTCAGCTTGGCGGGGGCGGGGGGCGCTGCCGCGGCATCGAGCGCAGGTGTCGAAGGGGCGGAGTCCGCCATGGCTGGAA
GGCAGGCGGATGCAGAAATGGCTGGCGGGATCGCTCGAACGGAACTCTGTCAAACATGATAGAATGCGTTTATGTTTTGGTATTGGATAAATTTGAGTAA
ATAAGATTATTGTATTCACTTACAAAAAGACAGTTAGGATGTGATGACAAGCTGATAATTGCGAGTTATTATGAGTGGTGGGAAATATGGCATTGCAGGT
TTCGTAGTACCGTAGAGCTTGTGATTTTGAAATGAATGTTCTTGTGGTCGCAAGATAAACGCAGCCAGCGAGTCTCGTACCCAAAGCGCAATGGCAGCAC
GCTGCTCGGCCTTGCAGCATCCTGATTCTAATGGCCTCGGCACTATCGCCTCCTTAAAACAATGCTGTGCTGAGAGTTCCGTCATATACTGTCTAGCGAA
TAATAGCAAGTGTCGTCTGCATCGTCCGAGGACTTAGCAATTACTTTTAAGCTACTGTAATCATTGGAACCTCCACCAAAACAACCCCCACATTAACGCA
GCTACTGGCAGTAGCCTACTGCACACGTCCGCTGTCCCCACTGCTTGCTTGTAGCAAGCTCACTTTCCCGAATGGAAAGCAAAAGCACACAGTTTCCTTT
CCGCCGACAGTTATTGATGGCCAACCAAAAGTAGAAGAGGCGCCATTTATTTTCACTATCTAGTCAGCATGACATCCGTCCTTCCCATCCTAGCCCTCAA
ACTAAGTACGATCACATGGACACAAAGCTACTGTAGCTCTTCAACGCTGGCCGGAGCTGCACCACTTGCCTACCTTGAAAATGGAGCCCAGCGCCATGCT
CAGCGCCATCACCTTGGCTCTACGAGGCTCCACGTAGCTCAATCATACTAGGATACTAGGCCTTGAAGGGGACACCCATCATTTGGACCTATCGCAGCAC
AGCTGGGGGTGCTGGTCGACTCCCAGTCCCACAATCCAAGCAGCAGCGACTGCGACAACATGGTGCTCCCTCTATTTATCGTCGGCGCGGGTGCGGCTAT
GGGGTACGGCATGTACCAGGTCGGCACAGCGCTGGCGCTTCCCCCGTCGGTCAGCGAAGCCCCACCCAAGAGCGCGAGCGGCCTCACTGCTGGTGGCCTC
AGCGCGGTGGCCGCGTACTCGGCACAAGGGCGAGTCTTGAATCGCTACTTGGCGCACCTGCTGACGTACGAGGTGCCCAAGAACGTGACGGTGTGGAGCT
TCCGTGATTTCCTGCGCGTCGCTGGGCCCTTGGTGGCGCCCCGCGCCGTCATGTTCTCGACGTCGGTGGCGCTCATGGGCTTCGTCTCGACCAAATTAGA
CCTGCCGCGGGATCACAAGTAGCGGGGTTTAACGCAGGCAATAAAGTCGCAGGCGCCTGCTCTGTGAGGGGCACAATACGGAGTAATGGCTTTCCTCTTG
TTTTCTTCAAGATGAAGTACATTCGATGCGGCGATACAGCTCTCTCGCTATGGTTGTGGGGTGGTCAACGAGGCTCGTACAGTGTATTGCCGGTGTCCAA
CCAGGCAGAAGAGGAGGACTGACCTTCAGCGAATTCAAGGTTGACTAGCGAAATACTGTTGATGTCGAAAGGAGGGCTACTCGGTCTGTTCGACAGACTT
GAGCTAACCGCTCCAGCAAGTTGTTTTGGCCGACACGGAGCTCACGACTTGCACACTGATGTGGTCTCCGAAAGCATTGCATTTCCTGAAGTTGTCAGCA
TGAATGAGTGACCTTCGACCAAGCAGAGGTACTGTGGCAGACTGCCAAAGCAGACGATGGTCGCAGCGGAGCAGGCGGAGGCACGCACGAAGTGCAAGAA
GGCCGTCATGTCCGTGTGTTCATCGTGTGAGTGCCATGATGACCAGGAACGCCCGGCACAACGCTCAAGCCCACGCATCAAAGTTGGTTTGCCACTCGGC
AATGCCAAGCAGTGTTCAGAAAAGGCTGAAGTTTCCGTGTGGGCGGGAAACGAAAGGGAAAGCACAGGTACTTCAACTCAAGCCTGCCGACTAATCATTG
AAGTTGGGGAATAATTCCAGTACGATAACTCAATTGTCGATCTCTCCGCGTAGGCGCTGCCTGTAGCTTCCCGGTGCTGGGTGCTTGGTCTCAGCAGGAA
GAGTTCTACATGCCTGCATCTTCGCTCCGTCAAGCATCGCGAGTTCATGCGCGCAATTCGATTCATCTTCATCGCAACTTGCTCCCCACTGTGTGGTCGC
TGGCTCAACGGCCGGGCGTCAATGCTCGGGCCTCAGCAGATGGCGAGGTGCACAGGTGCGCGTGGTTGAGGTCCGCGCCGTGCTCACTTTCTGCTTCGGC
GGGATTATTTTGTGACTAACTTCAGTTATTTGAGTGTCGTAATCGCTCGTGCTCCAGGATTGCGCGCCGTTCGCTGCTCGACCTGGCTCAGGAGTGAAGT
TACACGTAAATGCTTTTGGCGCAGCAGCGCTGAACCCACCCGAAGCAGCGC