Description :
From Genome Similarity Track
Location :
Scaffold_15:127207- 131677
Transcript NameFunction/comments
Physo_321562Hypothetical protein
Physo_567885glutamyl-tRNA(Gln) amidotransferase subunit, putative
Physo_343562ribosomal protein L28, putative

Sequence
4470 bases(100 bases per row)
TCCTTCGCAGCAGTTTTCTTGGTGTCGTGGTTGGCCTTGTCCGCAACCTGCTTCTTCGTGGCCGTCTTCTTTTCCGTCTCACTCTTCTTCGTCTGCTTCT
CGACGTCCTTCTTCTTCTTCTTAGCGTCCGGAGCTGCCGCAGCAGAGGAATTCTTGGTCGGAGTGGCAGTCTTCGCCTCCGCGCCGTAGTAGAGATTAAC
CATCTCGCTCGTCTTGTCGCTGGGAGCTCCGGCCGCGATCTGCTTCGGCTGTTGCGTCTGCGTCTGCAGCGCCTTTGCCTTGTGCTTGGAGGGAGCAGCC
TCGTTCATCACGACGTAGATCTGCTCCATGTTCGTGAACACGTTGCCGGCCTGCACGTTCTTGGCCAGGTCCACGAAGCAGTGCGGCGACTGCTGGCGTA
CCTTGGCGTGTGCGCGGCGGTCCACCACCAGCTCGAGCGACACGCACTTCTGGATGCGCAGGTCGCGGCTCAGCGCCGGCAGGTGCGGGAACACGCGCGC
AAACTCGTCCACGATGAAGTCCTCCAGGTTCGCGATCGTGCGCAGGCGCGGCGTCTGCACCAGCATCACGCGGTCGTCCCGCGGCAGCATGGCGAGCAGC
ACCATCTCGCCCTCCATCGTCGTCAGCGCCGTCGCCATCGCTGTGTCCACACGGTAAGGTACCGACCGGTAGGCACTGTACTCTGCTCGCCCAGGTCAAG
CAGGAAATGAATGACTCAATGCGAATGGCTTAGAAGCAGTCGTACCTAACCGAGAGATCCTATGGAGCGCTTCATATATTGTGGGAACCGATTAGATTGT
CCAATTGGAATATAAATCGGTTGGTTAAGCAGATGATTAAGCTTAATCGGGTCGGATTTACTAAATCCGACCTCCTAATTAGATCGACAGCCTAAGCTTT
GCACTCTGATTTGACAGAGCAGTCTGTTGTGCCTGCAACGCCATGTGGCAAGCTGATTTAGCTGCTCAGTGGCTTACAAAGCTCTGGACGACTGATTTGC
ATGCTAATCAGCCCGAATGTCCGACACCCACTCGGCATTCGGCGGCGGATTTAAGGTAAAACCGACAAACGCTAATGCTGACGAGAAATGACAGCGCAAA
TATATGGCTTCACAACTTGATAAATAGATAGCAGTACACGTCGACTGCTCACAGAGAAGTATTTAATACACGCGATGCTATTGCTCGTTAGTAGGAGCGC
GAAACAGTCAGCTCGTGGTGGTAAGTGGTCGTTCCGCGTATTGCTGGCGGGTAATGAGGCAATCCCTATTTTACTAACGCTACACTGATTTATACCCTTA
CCGATGACATATGCAATTATAAGGATCCCCGATTTAGTACCAGTCAAATCTCTCATGAACGCTGCTTTATCAGCTAATCCGCTCGGACAATCTAATCGGT
TTCCACAATAACATCCGGATAGGTTTGATGGTATCAGCGTAGCAAGCACGAAGTTAACTAACGTTAAGCTTAGTTAAAGGGCTTGCTCACCTACAGCGGC
AGCCAGAAAAACAAGGAATTACCATTGTTTTATCGGTTGCCTTGATTGAACTGCTAGAAACTCTTATCACTCGAACGAACTCACGGCTCTTATCTTTCAG
TTGCATACACGCGCTCCGGAACGAGATCGCCGAAGCTGGCACGTTGCTCGAGCGCGTTGGCCACCTGCAACATTCGCTCCTCGGTCTTGCGAGCTCCCAT
GAGCTGCAGGCCAAGCGGGTAGTCGCCGTCGGTCGTTAGAGCCGCGGGAACGGAAATGGAAGGCACGCCGGCCATGTTCGCGGGCACAGTCATGACGTCG
TTCAGGTACATGCTCACGGGGTCCTCCTTGGCCTTCTTGTTGTGGACGGGGAACGGACCCGAAGGCGTCGTCGGGGTCAACAAGACGTCGACATCTTGCT
CTTCGAACACCCGCTGGAAGTCTTGGCGAATGCGTTGGCGCAAAACCACGCCGCGCTCGTAGTAATCGCTCATCGCACCGGCGGATAGCACGAAAGTGCC
CGAAAGGATACGACGCTGGGACCAAAAAACATCAACAAAAACGTTAGGTCACTTCCAGCAGGCGCCAATGTCTCGTAATTCCAACCTGCACTTCTTCTCC
AAAGCCCTCAGAACGTGTTCTGCAGTACAGATCATGGAGAGCACCGGACTGGTCTTCTTGCGCCTCCAACGCAATGTCCTTCGCCCTAGTAATAACCAAA
ACCATCCGTTAATGAGTGCATTCCTGTCGAGACACACAATATTTTCGGATCCATTTACCTGTATCCGTAGCGAACACCGTCATAGCGAGACAAGTTGGAG
GATGCTTCGGCGCAAGCTAGGATGTAGTACGCAGGGATGCACAACTTCGTCGTCGGAAGCGACACACTGACGACCTGCGCTCCTGCTTCACGAAGCCACG
CGACGCCCTTATCCCAGACGCTCAGAATTTCCTTCGGCAGCTCTTCCACGAAGTACTCAGCAGGGACGCCGACACGAACGCCCGTCAGATCCACATTCTT
GGATTGCTGCGAGGCCTCAACTGTGTTGGAGCACTGCAGGCAGCAATAAAAATACAAATAAACACTCAGCACTTAATGCAACTTCAGAAAAATGTGGGCA
GTGGTGCCAAACCTACCCAAGCTTCAGGCAACGCGTCAGTCATGCAGGTCGAGTCCATGTGATCAGGCCCCGCAATCGCCTTCAGCACAACAGCAGCATC
ACTGCACCGTGACACAATACACAATCAGCTCTTGACCACTAAAGCGCATCAAGCGCCAGTACCACCTCACTCACCCAACCGATCTGGCGAAAATGCCCGG
CGTATCCAGCGAGCTCGCGTACGAAATCATGCCATGACGGGACACCCGGCCGTAAGACGGCTTCAGACCCACAATGCCGCAGTACGCAGCGGGCTACAAC
GAACACACAATAATCAAACCTTATCAGCTCTTCATCCTCCATCCCTCCACCCTCTCAAATGTCACCCACCTGACGGACGGAACCTCCCGTATCCGACCCC
AGTGCCGCAAAACAGCATCCAGACGCCACGGCCGCCGCACTGCCACCTGAACTGCCGCCTGCCACCACCGCGCCGTCGCCCAGATCCTTCGACCACGGGT
TGATGGTAGCGCCGAACTTGGAGTAGAGCGTGGCGGAGCCCATGGCGAACTCGTCCATGTTGAGCTTGCCCAGCGGCACGGCGCCCTGGTCCAGCAGCCT
CTGCGTGGCCGTGGACTCGTAGGGAGGCACGAAGCCCTCTAGCACCTTGGATCCAGCAGTGGTGGTCAAGTTCTTCGTGCAGAAGATGTCCTTGAAGGCC
ACGGGGATGCCGTCCAGCAGTCCGCGGGCCTTGCCGGCTGCTCGACGCTCGTCCGACGCGCGCGCGAGGTCCAGCGCGCGATCAAAGTCCGTGGCCACGA
ACATGTTGAACGCGCGCGTCTTCTCCACCTGCTGGATGCACGCCTCCGTCAGCTGCACGGCCGACACGTCGCCGCGATCCAGCGCTTCCGAGGCCTCCAG
CAGCGTCTTGCTGCACCAGTCGCTGACGCTGCGCGAGGTCACGCCGCGCCACGCCGACTTGGCCGCAAATGCGCGCGACCTGTAGGGTCACACACATATA
AGAATGAGTCGCTGGGGTGCAGCGAAGCCGGAGATATCCATGCAGCACGCACCGCTGGGAGATCCCGCCGCGCATCATTTTCGACCGCACAGGTATGTGG
CGTTTTCAATACTGCCCAACAGCATGTTATAAAGCTTTCATGACATTTGACAGGCCCACGCAGAATTTCCACCAATCGACGTGATTATTGTTGTATCATC
GCCGTGGATTCGCTGAAAATATGTCGACGTAATTACGCTTCAGCGCGTGTAAAAAGTCGGCGCCAGCTTTTGACGGGAGCTTGGGCGAATCGATTGGTCG
AGCGACTCGCTGGGCCTGCCGCGCTTCATCGGGCTCCGCCATCCCATTATTTCCATCGAAGAAGCGGAAAAGGTGCGGCCTCCGTCCGCTCTGCAAAATG
GGCCCGGAAGGCAATAATCACCGCACTACATTCAGGTTGCTAACGTGAAAAACTATAAAATGAATGCGTAATCGCCCTCTAGATGTCGAGCGACACCCTT
ACCTGGCTGCTGACCAAGAACACGTCGTCCTTCCTCGTGAAGCGCAACGGCAACGAGTTCGCGCGCGAGAAGTTCAACCTGCTCAACCGCAACTGCCGCA
AGTACTCGGGCCTGGCCGCCACCAAGGCCGTGGACGTCTCGATCGCGGACAAGAAGGTGACCCTCTCGACCAAGATCGAGAAGGCCGCCAAGAAGCCCGT
CAAGGCCGTGAACGCCGTGCCCCTCCGCAAGGGCGCCCGCGGTGGTGCCAACACCATCCGCGCCAACATCTCGCGCAACTACTACCGCCGCGACCTGAAG
AAGGCCGCCCTGGCCAAGTGGTCGCGTCTGTCCACGGTCGCCAAGGTCGAGAAGGGTGCGTCACACACAG