Description :
From Genome Similarity Track
Location :
Scaffold_696:12719- 15275
Sequence
2556 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGAGGTGCCTGCTTGAGACCATATAGGCTCTTCAAAAGCTTGCAGACTAAGT
GCTCTTTTCCACGAACAGTAAACCCTTCAGGTTGCAGCATGTAAATTTCCTCATCGAGGTATCCGTTCAGGAAAGCGGTTTTAACATCCATTTGATGGAT
CTCAAGGTCAAGGAGTGCTGCAATCGTCAGTTAAAGTCGCAGCACTTCTATGCGGATCACTGGAGAGAATATCTCATCGTAGTCAACGCCATACTTTTGC
AAAAAAACTTTTATTACCAGGCGGGCTTTATAGCGGTCAATACTGATTGTATTTTACAACGAATACCCATCGACACTGTAGGGCCCTTCTCCCTGTCGGT
AGTTTTGTGAGGACCCACGTTTTGTTGTCAATCAATGATTTGTATTCACAAATGGCTGCCTTCTCCCAGTGTTGTGCTTCTGGTAGTTTCTGGATATCTA
GGAACGTCTTTGGTTCAGATATTTGTCTGATAGCCAATAGAGCGTAGATCTGAGTGAGGTGCTCTTTTCGTTCGTAAATGTCGAGTGGATCATCAAGTAG
ACACGGGTGTTCATCCTCGTTCTGAGCGTTCGTTTTGTGTTTGACTTTCTGCATCTTTACTACTACTTCCGCGGCAAGCACATTGACGCTACGTTTTAGT
AGTGAGGCTATTGAAGGTAGCAATTGTGGTGTTGGTAGCGACGGTGATAGCGTCGGTGCGGGGCCATTTTGGTCCGAGATTGCTGGTGTGGGAACTCGTC
TTCTCTAAACACAACATCCCTGCTGTAGATAACACGGTTTTCTTTCGTGTCAAGGAGTCTATATTTCTTTTTGTTTGATGGTAGTCCTAAGTACATGCAT
TTCTTAGCACGTGGTTCTAGTTTTGTGCGGTGTATCTCAGGGATAAGAGCGTATGAGGTACACCCAAACACTTTGATGTAGTGCGCGGATGGTTTTCGCT
TGAACCCATTTCTCGTATGGGGTGACCTTATCGGTTACCGAGCTGGGAGTAATGTTCAGAAGGTCAGCAACGTGTTTGACGCATTCTCCCCAAAGAACCT
GCGGTAGGTTACCATCAATGAGGAAAGCCCTGGTTCGTTGGAGTAGTGTACGCATGCGCCTCTCTGCAACTCCATTTTGCTGGGGCGTGTACGCATTTGT
AAATTGTGCGTGCGTATTGTACTTCTGAAAAATCATTTTTCCAAGTTTCTCATATTCTCGGGCATTGTCGCTTTGAAGATGTCTAACTTCTTCATCGTGT
ATGTTCTCATTGAACTGGAGTTCGCCTACATCAGCGCGAAAAACGTTTTGTGCTTTCTTGCGAAAATCTTCATAGCATTCGTACAGCTCAGACTTTCGCT
TGATGATGTAGATGAACATGTACCGTGAGTAGTCATCTATAAAGGTCAGAAAATATTGACACCCCGAGAGTGTGGGGACGGGTAATGGACCAGCCATATC
AGAATGAACTTTTTCAAGAGGGAACTTTGCCCGTTCAACGGTACGTTTATTGAATGGGTTACGATGGGCCTTGGCGTATGTGCAGGAAGAGCAAAAGTAG
TCTTTCTTGGAATCAAAGTCCTTCAGGTCCATGTCCATGACAGTGTTGGCTTTAGCCAGATCCTGCATAATGCGAAAGTTAGGATGACCCATTCGTTTAT
GCCAAAGTATAACATTATCAGGCTTACCTGAAGTGGCCACATGGGCTACCTGACTTGAGGTTGCCGGGCTCGCTTGAAACTGGTAGAGTCGAGTCCCTTC
ACCAATTTTGGCTTCAAATTTGGTTCGGCTAGCGAAGAACAGAACGCACTTCTTGGCGTTGGGGAAGTTGATTTTGAAATCATCTTCGACGGCTTGGCGC
ACGGAGAGTAGGTTGAACTTCAGCTGGGGCGCATATAGCACGTTAGCCAAGGATATTTCTCGTTCCTTTCCCTTCGTGTCCTTGATTGTCATCTTGACAT
CACCAGTTCCTTTTATCGGAATCTGGTGATTGCCGCCGACAGTGATTGACTTGCCAGCACTTGGGATCAGCTTCTCAAACCACTTCATGCGCCGAATATT
ATCGATCCCCCCGAATGCAGCTCTTCCACCTGGCGTGAGCTCAACAGCTCGTGTCGATCTGCGCATCGTCATGGCGATAGTAAATGAATAAAAAAAGCAC
TCATGTGGTTCTGCTGCCCTCTAATCGGCAGCGTGAATTCATGCGATTCTGCTTTG