Description :
From Genome Similarity Track
Location :
Scaffold_426:12716- 14811
Sequence
2095 bases(100 bases per row)
GTCGATTGATCGATTTCAAGCTGCCATCGTGCTGATTCGATCTGAGCGCTTCTTTCTCCACTNNNNNNNNNNGAAGATTATTAAGTGTCTTCCAGTGATA
TCACCTTGCCAACTGATTCAGATGCCAGCCTTCTATCTTCATATNNNNNNNNNNCGTGCTGTCTTCTTCTTTTTCGACTTTGCATGAGTGGTCTTGGGTG
CGGTTGTCCCCGAAGGGNNNNNNNNNNTCATTGGAGCCCCTCCCACAACTCCGATAATCTGGAGGATCCTATAAAATCACGCGTCTGCGGCGATCCNNNN
NNNNNNTGATGTCTGTCAGTGATATCCTTTCGCAAACTGATCCAGCTTCCAGCCTTCCATCTTCATATTATCGTCCACAAAGTTGAGTAGCCAATCGATC
GATTTCAAGCTGCGATCGTGTTGATACGATCTGGGAGCACCTTTCTTGACTCGTGCTGTCCTCACGTTTTTCGTCTGTGACTTTGTATGAGTGGAACTGG
GTGATAACTGTTCGGTTTTATCCAAACGGTTTTCACCCAGCAGATGTGTCCTACGGCACGATTCGCGGTGGTCCTCGAAGAGACCTCAGGAGGAGGTCTA
GGTTTCTCTTCCAGAGCGATCGATCAATCTTCCTTTGATTATCTTGTCATCAGAGCCCCTTCTTAAAATTCCGATAATCTAGGGATCCATTAAGATCACG
CGTCGGCGGCGATCCCTTTGATTCTGAAGCTTCCATCCCAGGTTCTGTCTTTAGTTTCACCTGTTCACTCCCGGACTCACGGTGANNNNNNNNNNCACTA
CGGGACTCACGGTGGAAACTTGAGTTACCAGAAGATCCGGGCATGCGCGCTATTGTGTTGGAGTGGGGATCGCTCATTTTATAAGGTGATCCAAACTCTC
TACTGCCACCCAGACGACCGACTAATGGAGGGGGTTCCATGCAGATGTATTCTTATCTTGCGTACCCGTCGGTAGGGTGGGCTGCACTANNNNNNNNNNG
GTGCTGTCTTCACGTTCTTCTTTTTCGACTTTTCTTGAGTGTTCTAGGGTGCGGTTGTCCCCGAAGGGACCTCAGGAGGGGGTCATGGTTTCTCTTCCAG
ATCGAGCGATTGATCTTTCTCTATGATTTTTTTGTCATCAGAGCNNNNNNNNNNCAGGGCATGCTGCCACGTGTCTTTCGATTTCCGTTGATCGTTCCTT
CACGTATNNNNNNNNNNGGGGTTGGTGTAATGGTGCGGAAATTTTTACACGATTTCTGGTGGACTAGTAGGGTGCTTGATATAAGTCACCCAGATCGGAA
GAGCGNNNNNNNNNNCCTCTGACGATTCAATCCCAGATTCCATCTTGATTTTCACCTTTTCACTCCGGTACTCACGGTGCAATCCCGAGTCGCCAGAAGA
TCCGATGACGNNNNNNNNNNACCTTGTCCAAATATGGAGATGTTTGAAACGCTTGACCTTCAAAAAACTTGAGCCGTCTCGCGATCTTGCACCTTGTACT
TGCAGTTGTAGCTGCGTCCTACCGCAGTAGGGATGTCTTGAGAATTCTTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATAT
TAACCAACCAAGAGATAAAACTACCAATATGCCGGTCTGTATATCAGGATATGCTGCTACGTGTCCAATATTACGTTGATCGTTTCTTCGTATATGTGGT
CCTCGTTTTTCTCACGCAGTCTCAACAGATCGGTGGGCTGGATCGTAATCACCACTGATCGTCGATTTCTATTCCTGATCGTCAATCACCCTGATCGTTG
ATCACCCTACAGATCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACTGCCG
ATCTTCGATCACTCTGATCGTCGATCACCACTCCTGATCGTCGATCATCCCTTCGATCATGATCACTACCGATTGTCGGCCACCTTCCTGGATCG