Description :
From Genome Similarity Track
Location :
contig_38:127137- 140438
Transcript NameFunction/comments
g8327.t1KUF94301.1 hypothetical protein AM588_10004944 [Phytophthora nicotianae
g8328.t1hypothetical protein

Sequence
13301 bases(100 bases per row)
ACTGTGGACAAACTTTCAAGCAATGGGTGCATCAGTTCCATCACTTCACCATTCGATTCCATAAGTGCAACACGACGCTCTAGTGCCGACACAAAGGACG
GGTCACGGACGCTCAAATGACCATTCTCCACAGCCGACGCCATTTTGTTCATAACCACTCCAGAGTTACCTGATCCAGCCTCAAAAATTTGCACAAGCTG
TTCTGCAGACAAGTTAATGCCCAATCCTTCGAGGAAATCAACGTTTACCAGCTCAGGGCACGTCTCGCAAAGGAAGCGGGCTGTTTTACTCTCCTTGAAA
CTCCACTCTGCAGCAAACAATCGGACCAGTCGGCCAACCTCCACGAGCTCCCACCGCTCTCGGGCGGCCGAATCAATGAGACGAGTATACAATGATGCGT
TGTGGCCATCGTTGTGGTCGATGTCAAAGTCACCACCTTCATCGCTATCTGAAGAAGATTCATCCGAGAGTTGAATAACTGGAGACGCCACAGCTTTTTT
AGCTGGGTAGGGAGTCACCAGCTTTATGCACTTGTTTGACGGCAACTTGAGGTTGCCGTGGTCCTTCGTGGGCAGGTAAGAACATGTCATCTTTCTTCTT
CGCGTCCTCTGCAAGAGAAGCCGCAATCGGTGTCAATTGTTTTGTCGAAGCTAGGGGCTCCTCCTCAACTGCAGCAGTGCCAATTATTTTGCTGGTTTTC
GCCTTCTTGGAGGCAACTACAGGGGCACGACCAGATGCATTTGTCGTGCTGGCGATTGACGTTCTGGATCATCCGACACAATCAAGGTTTTTCCTCGTCT
TGGCTGCGCTGGAGCGAGCGTCTTGGGTGATACGCTGTTCAAACTCGTTGCTTCGGGTGACTTTTTCCGTTTTTTGCGAGACTTCGGTGAAGGTGCAGGC
GTATCCGATGGTGAGGTATTTTTCTTTATCAAGTCGGCGCCCGCACTCTTTGCAGTAACCGCGGGTAAATCATTTTGGACTCCCTTCGAGTTTGATGCCG
AGGATCCAGACGTATGGTTGCTGCCACAGGTAGCCTTCTCTCGAAGTTCTTTGCGTTTTTTCTTCAATTTCTTAATCTTCGTCTTGGATGGATGTGCATG
AGGGTCGCTGCCATTGTTGCTGTCGGTAGCAGGTTGCAGAGCATCATTCTTCTTCTCAAAAGCTCCAACACTCTCCTTTGCCTTCTCCATCTTCGAAACA
GCAACGGCCTTGCGCGCCGCACTCTTCTGCTTCTTATGAGGCGGTTTGACTATCTGCTGCGTAGCAATCTCCTTCATCTTTCTCAAAGCCTGCTCCAACG
GATCCACTCCATTGTCTTCCTCATGATCTTCATCCTTCTTCATCGCATGCCACGGCGCCTGCACAGGCACCTTGGTCATTTTCACCGCCTCCACCGAATC
CTGCTGCTTCTTCTTTTTCGTCTTCACCTTCTTCTTCTTCACGTCTTGGACAACAAGAGCAACAGTTTTCTCCTGCTTCTTAACGATGGCGTTCGACATA
CCCGGCACGGTCACGACTCTCGCCCCAGCCGCCCCCTTCTTCTCCACCACTTTCTTCTTCTCCTTGGGCTTCTTCTCCTTCTTCACTTTGTTCTTAACGA
ATTTCACCATTGGCACGGGCTCTCCGTCGTCCGCAAAATTCTTCTTTTGCTTCTTGTGCTTGGACTTGAACAGCACGCGGGGCGTCTCTGGGGCCACTGC
AGTTGCTTCTTCCTGCGGTAGCTCGAACATGCGCGCGTGGAAGGATGCCAGCCGCTCGCGTGCATCATCATCACCGCCTTGGAAGCTCTCGGAGCGCTGG
CGCTTGCGCTTCATCTTGGCCAGTGGAGCAATTGGCTGCGACCGTTTCGATCGTCCGAACCAGCAGCTTTTAAGCCAATGATAATGCAATATTTATATTT
CCTACCCAATCAGATGGCTAGTCCGAAAAAGGCAACTATTAACTTGGAAAATGAGACCGTCGACGCTGGCGGTGGGCTGGTGATTTTGGCCACGTGCTGT
GCTTTAGGCGTGTACGGGAAGCACTCGCGATACACTGAGAAATGTGGCAGGAAGACCAAGCAAGATCGTCGAGAAATGTTGCGCTCCAACCGCCGCAGTC
GCAAGGACAAACTACTCAAAGCCAAGAAGCTCGCGCGAAGTGAAGCGGTGGTTGCTGAACGGGCTGGGATGACGGAGGAACAAAAGTGCGAGCAGCGAGA
ACGGATCCGCATGCAACGTGTGGAGCAATACGTGAGTTTTTTTGCAGTGAAATAGTATGTTTGAGTTGATTTGGGCACTGAACTTCGTTGTGTTTGTGCA
GCAAAAGCTGGAGGAGGCTCAGTTGAGTGGCATTCGCGTGGTGGTTGACTTGGTGTTTGCCGAAGACCAGACAACTCGAGTGAGTTTCACATTTGAGATC
TGGTGATAAAGTTGTTGTTGTTGCTGACGAGCTGTAATGCGTTAAAGGAGCGTAACAGCATTTTCAAGCAGCTCGGTGTGTGTACGGGTATCTGAAAACT
TGTCCGCTAGACAGACTTCTGTCGCTGCATCTCGCCTCCTGTACGCAAAAACTTGCTGCCGTTTGCGCTCAGCACGGTGTGCTACGTTGGAAGGTATGGA
TTATTGTGACCTTGTGCTGCAAACTTGTGGGCCTGACCATGCTTTGATGCAGGTCGGAAGGCACGAAGAGCCTCTCGAGCAGCTGTATGACGTCGGCGAA
CTCGTATACTTTCACCGGACTCGGATAACGTGCTTGAAACGCTGGATCCAGGCTGCGTGTATGTCATCGGTGGCATCGTCGATCGATCAGTTCGCAAGGT
ACTTAGCGTAGCCACTGAATTCTGATGATAACCTACGAATTTGCCAGCTCATCCGTGAAATTGATGGGTTTTCTACAGGGCGAGACGAAGGCAAAAGCGG
CTGCGCATGGCATTCAAACTGCACGATTGCCACTTCAAGAGCACTTTGAACAGACCGGAGCACGAGTTCGAACTCACATCATGAACCTAGATTCTGTGAT
CATTACGCTGAACGAAGTGGCAAATCATGGCGATTGGGGGCGTGCCTTTCGGAAAGCGGTGCCGCTACGGATCTCTCGCTCAAAACAAGCTAAGAAGAAT
CGCGTGGAGAACGATGCTTAACTCGGGCGCTGGTGAGCGTGTGCAAATGGTGGGAACCTTAGTTAACGTGTTGATTGAAAAATAAAATATGAATATGCAT
CCTCATATCGATACAACGAGGGGTGATCTGCTCACTCTCCAACCATGGTGGCCATGCCAGCAATCACGCTTGAGACTGCAGCAGTTGCCGTAGCTGTAGC
AGTGGCGGCAGCATTGGTCCAGTTAATGCCTTGGCCAGCTCGTTGAGCTACCGTCGTATTGTCTGCATCGATAGACTGGCAGTGAGTGATGGCGTACACG
AGTTTATCGTGCATGACTTCACGACACGAGTACGACGGCAGATCGATGGAAAAGAAACCTGCAATACAACGCCACAGCGTTAGTATGGCGCATTCACGTA
CAACGTTATTGGGAAGCATAGCTTACAGGTATGAGCGATGGGCAAGTACATATCAGCACGACCCGCAGCCTTCGGGAGACCCGAAATCTTGAAGTCCTGC
GTGAAGTCTGCTGCATGTGTAGGCAAACGCGACCGACCCCTGTAATAGGTAAACAGAACAACAGATTAGTGCACTGAATAACCAAACCAAACTTAAATCT
GGTGGCTCTTACCAGACGAAGCGAAGGAACGATGATTTCTGCTCGGCGGTGAATTCTGCCAAGATGTCCCAGAAGTAGGCAATATGCGGGTCTGTTGCTA
GACAGCCGTCGCCGTATATGGTTCGCCGCCGTAGAAGAGCAATATCTACGGAGGCTTTGCCGCACACGAGTGTCCGCAACTCATGCCACGAGAATAGCCC
CAGAGTAGGTGCTGGTAGAATCGTTGCTATACCACGCGAAATGTCCCCACATACTGGCGCGAACTCAGTAAGACGGTATGTCTCGACTGCTGATGCGTAC
TCCTCACGATCTTCCCACGTAACGTGCAAATGCTGTCCCCCAGGCACTAACTCAACTGTCTCCCGCGTACTGGATAGCACAGTAAAACTTGCATCCACGA
TCTCATCGAACATAGTCTCCGTAATGCCGTGTGCATCCAAGTTCGCAATCGTGTCCACAACCTGAAAGCATCCCTGATGGACAGCTTCAATATCGTGTCG
TGTTACATTCTGCCCTACCAATAGTTTCCACACCACGGGCGGAAGATTCAGATCCAATGGTGTTTTAGTTCGCACAGCCACTCCTGCAAGTTTGCCGAGG
AACTCGGCCATCTGCACCCGTCGCGGGTTTGAGCGTAAGTGTGAGTTTGGAACGAAAAGCTCACGGTTTTCGCCCGTGTTCAGCAATGCGTTGGGACACT
GTCGAAGTACAGGCAGCAATGGCGTACGGGTTTGCAACTCGGAGCTCAGCTGTGCCAAACACTCGCGGTACAGACCGCCGAAATCGTCTCCAAATTCGCC
GACAAACTGGCACTTGAATGCACGGTCAGCCCCACGTAATAGAGCAGGTTGCAGTCCGTGAAGTTGCTCGAAAGTCTGGGCGAACACACTATCCCGCTCA
CCAGCTTCGCTAGACAGCGGATCACCACGCTCCGATAGTTCCAGTGCATCATGAGCACGGTTGCGATCGACTTCAATCTCTGGACGAGCTGCTGCTGGAG
CTTGCTGCTCTTTGAGGACTCCGAGCCACCACGCAAGCTTCACGTGCTGAAAGACCACACCACGAAGCTCTCGAGCCCCACGAGCTAGCAATGAGTGCTC
ATCCTGGGCTGAGAAGTCGATAAATGCCAGTGATGTCTGCAAACGGCAGTTGAAGTTACGTAACACCAAAAATCGGCGTTGGAGTGTCTCCAAGGGTACG
CCTCGCAGTACCGGGAATCCCTGTAGTTGCTCTTCGGTTGGAACAAACTCCTCGGGAGCCATACGCAGTGGGTCACAGCTTAATAGCGCCTCGGCACGAG
TCTCGCATATTTCGTTTACGAGCTGCACAAGAGCGCGATCCCGGGCTGGGGTAAATACACGCTGGGATGCGTGCAGGTGGCGAAGCTTATCACCGTACTT
GGTCGCTAGTAGCCGGCGGCCTGTTACTGAGAATTCTGGGACGGCAGTGAATGCAACACCCCACTTGGTGTCTCCGGACGACTGCTGTTCCTGCTGTTGC
TGCAATAAACTCGTCACATCACCAGTAACAACCTCTTCAGCGGATCGAACCGCGTCAGTATCTCCCTGAGCAGGGGGCGGAGGTGGAATTGTGCTTGAAT
CCAATGCTTCATTTTCTAAGTCCTCAGACAGCGATAAGGATTGATCATGCAGTAATTGACGGTGCCGTGCGCGGCGTGCCATTGCTTCTGCTTCTTCGCG
AACGAGTGCCTCCATTGCGTGCATGTTCGCCAGAATGAAGTCAGCAGCCTGCTCTGCATCGTCTTCACAGTGGCGGAGCGCGTAGACGCACCATTCCATA
GGGAACCCCATTTGGCTCAACGCAATTCCCAATTCCATTCGGAAGTTTGGAATTGAGCCATCACCCAGGCTTCCTTCGCCAGCAAATCCACCGAGAGTGT
CTTCTTCTTCTTCACTGTAGTAGGAATCCTCCCCACTCACCAGTCCGCTACCGGTTCGAGGTAGTCCCGGTTCAAGACCCCCATCCTCGACTCGGTGTCC
ACCGATAAGATCGATGGAGTCTCGCTGGTTGTACAATGCAAATCCAGGGTAAAACGTACCCTCAAGTTTAGGCCCAGTTCCACCAGGACCAAACGCAACA
CCCAAGTCCTTTCCATTGAGTGCGTAGCTAAGCGTACCGCGCCGCAAATCAAGCGTGAGGCGGACAATATCTCCAGTCTTAAATTTGTCGCCGTATGTAC
CACGCTGCTTGCTGCCATTGTGCCAAAGCGCACGATTGCCAATCCAGCCCCACCCGCGGTTATCTTTGCCCAAGTAGGAGTCTAAGCGTACGTCGCGACG
AGCAATCCCCAAGAAGATATTTGAGCTTGCTGTCACAAACGTAATGCGTACTTCCCAAATGTGCACACCTCCATCAAAACGCGCCACACCAATACCTGTT
TGCCAGCCTTTATCACGTGCGAGAGAGAGCCGAGTGTCTCGTGCTTCAAGCTTAAGATATGGGCCTTTACGCACACGATCCACACGACACTGGAAATTAG
ACTGCACGGGGAACCGCCACACAAAACTGTCTCCATCGATGGTGACTTCCTGCCCTCCGCAGGCCCCTGTAAATGCACGCACTTCTGCTTCGCCTCCTCC
GCTGCCTTCAGTGCCTCCTTCACTTCCAGCAGCATTTCCACCCTGCAGGATCTGCAAGCAATGAGAGCTAGCTGTCTCACTCTGAGGGTCTAACCGCACG
CGAATACTGGTAGCAAGCGGGATACTGACGAGTGACTCTTGTAGGTCGAGATCGTATGGATGTGCACTCTCTACGCGAATACACACATCCTCTGAAATGT
CTGACAAGAAATTGTCAGCCGAAAGCATAAATTCATCGGGTAACTGAGCCTCAATGGCAGGGTCACTTGGTGTCCCTGTCTTCTCACCATCAGCGTTCAC
TTCATCAGACCTCGCGGGATCCATTAGCGCTTTCATCACGCCATAAACTTGACTCAGAGGCTCAAACCACTCGAAAGCACTCATAAGATTATCACAGTCA
AGCGAGTGGAAGCGGAAACTGAAGTTCGCGTTCTTCACTGAAGCTGTCGCTGTGGCACCCAGGTTGGCGAGCAATTTGCAGTCTGCGTTGAAAGAAATGG
TAGGGTGTAGCAGTTGTGGTCGTGAAATACTCGAGAATGCAGTACCCAGCAGCTGGCCATTCTTGCAGAAGAAAAGCTCTTGAGTATCTAGGCGCAAACC
ACAGCCAAAAACATCACCAGGGCTTACAGCACCTGCAGGTTCAACCCAGCGCCAGCGATCCACAAGAGTGTCACCAGCACACAACGCTTGGCCGTTTGCT
GGAGCAAAAGAGTAAGATCGAGAGCCGTCAGCACTGCCGCCCACCAATACTCCTTCAAGTGGGAACGACGGTGGTGAGAAACCCAGCGCGAGCGAGCCTC
CCATTGTAGTGCTTGTGCCCCACTCCACGACTGTGACTTCGAAATACACAATTTCGGCTTTTACCTCATCTCGCATTGTCATCATGAGAGCTGGGGTATG
TTCGAAGCGGCAAGAGTACACCTCTCCGGGAGGAACACCAAGTCCTTCAGCTGCCAACGCTTCTCTCGCCGCCGTGTTGCCGCTGTCTTCTGCGCGATAG
TCTAGCAAGAATTTACGCTCTTCGCCAGATAAATGACGACTGACCGCCATTTTGGAAGAATGGCTCACCAGCATCTCCACGAAAGGCTGTTTGGAAAAAT
GGAATCGGTACGGTAGGCTCAACGAGCCCCCTCCATCTCGTTCTAAACAAGCGGCGAGCTCTTGTATACGCACACCGCGTTGCTGATCCTCGACAGCAAG
CATCAACTCTACAAACGCCTGCAAAAGAGCATGTAACGTAAATCCGCCGTCTTGGTCTTGGCTCAAAGCCATAATCTTGGAGCGACAATAAAGTAGAGCT
TGCTTGTCATACCATGTGCACCACGCTGGATCACCGTAATGAGACCTCGTACAAGTGCGACTGCAGCCTGCCCACTAGACGGCTGGTTTTCACGCAGAAC
TTGCTGTACGAGAGTAAACAGAGCCGCCGGCAGTTCGGGGCGTAACCGTATTGAAGTATTTTGTTTCGCCGGCTTGCTAGATAGCACCCGCTGATATTGC
AGTAGCAGCTCGAGGAAGGCGAGCACATGGTCCACACTTATTGGTGCACACAGAACCAAGTCTTCATCTGAGAGACTCACCGCGAACGCCGTGCTGGGTT
CAGCAGCGCTAGTGTCATTCAGTGTAACAACCGGTAGAAGCAAACCAGTGCTAAACTCCGACTCCACTGCCCAAAGAGACGTTTGAACAACAACGTCGTC
AGCAACGGGCAGCATTAGCTGCATTCGAGAAGAATCAATCGCCTGGTTCTTGGTGTTACGACTATGTGGGGTCGGACCATTCTCGCCGGTGGCATCTTCT
TCGTCTTGAGCTTCATTCTCGACTTCAATCGTCGTCGGAAGCTCAACACCTCCACCCCCTGTGGAAGCAGGTGAAGCTGCACGCCAAACACAGTGAAACG
AATTAACACGTTTCACAAGGTCTTCGCGAATACAACGTGTGCTGGAGACGTCTGGAGGCTCAAAAGGGTCTTCCTTGCTTCCTGCTACGCATCCTAATGC
TACGTACCCAGCTGGTGCAACAGGCCACCAGATAGAGCGCAGCTGCTTGCGTTGAAAATCCGGATCACTTTCGGAGTTCTTAGGCAAGCCTTTTCCAGTA
ATATCCACACGCTCAAAGCTGGTAGGTGGGGCCAAAAACTCTTGCTCATCGTTATCGTAAATCAGTAGCATTGGTGCATCAGGAGCACCGTTACCACACT
TCACCACATCGCCAAGGCAGAACCATTTATTGGTAGTGTCCGATGCAGCCTCCGGCACTGGAGGTAGCGTCGGACGCCAAATTGTCACTGCATGATCTGC
AGCAGACTTCATCCAGCTATTGTCACTGCCGAGTGAAGACGCGAAGCGTTTTCTCCACTTGTGGCGATACTTTAGTAGTGGGTCAGGTGGTGGAATACTC
CACAAGCGCTCGTATGTGTCAACCACCATGACTTCAAGGCCGCAAGAAAGCAGCACAGGTCCCTTCGGGAAGCACCGTCCGTTTTCCGATTTCGAAGAGG
CGAACTTTCCCACCCCAGTGCAGTGGCTGGTGTCGCATGCGTACGCGAAAGAACATGCAAGATCGTTTCGAACGTGATTGCATCCAGTGTGTTGGGCTGG
TACAAGTCATTGACATCCTCTCCAGCGTCGACCCTGTTCTGATCATTCTCAACAAGGGATTCAACAAGCTGAGTAATGCCAGACCAGCCTAGTTTTGCAG
GGTGTTCCATGACTTGGTCGATTGATCGCTGCACAGTTGACAAATTTTGTGAAGAGAGCAGGTTTGATACCAAAGTTTCTGTTGGAGAGCGTGCCATCAC
TTCGCGCACCATGCGCGATAGGATCTGCTGAATCTTGCCGTTCTTTTGCGCCTTCGGTTGTTGATGCAACTGATACTCTGTTTCGTGCTGCAAATTCAAA
CTCGCTTGATGGGGAACGCTCAAAAGCGTAATCAATCGCCGAAGTACCAAAGGATTCCCAAGATCACTGAGAGGTGCGTCTCCGGTCTGTGAGGCATTTC
CGAAGAGCCGTACAATCTGGACAAGAATTGTGCGTGCATGAATAGCTGCGAGGCGCTCACATAGTATCTCTTCTTCACGATCGATCTCAAACGCGTTCAT
TTGTCGTACCGCATCGTCAAAACTGCTGTTGCATTCGCTCCAGAGCGTTAACTCTGATTTGCTGAGCATCAATTCCAAACCGGCACCACCAGCGTTATCC
ATCTTTTTGGTTTTAACAGGACTTCCCATCGCTCTGCTAGCAGCACGGGGAGGCACAGGAGGGCACAGTGCACTGGATTCTGTGAGAGCGTAGCTTGGGT
TTTCGTCTCCGATGTCCTGAAAGTTTACCAGCGGCTCACTAGGCTGTTCCGCAAGTAGGGTGGCATCCGTTGTAGTGAGAGATCTGGGCGATGACACTGA
ATTTTCCAGTTCTGCACTTCGGCTTGAAAGTAGTAAGCGTAAAGCATCGCCGTAGCTGTTATCTGTTTGGCGTAGAGCTTCAGCGCACACTGACTCAGAT
CGACCAATAACCATTGCTAAGTGGCGCACGTTTGAAGGGTAGCCACGCTGTGCGGTGTTGCAAAGTTATAAAAGTAAACGTTAGACCTATCATCATATGC
ACTTCTCGCAAAAATACTATAACAGATACTTACCAAGTGAAGCCCACGACTTTGCTGAATCACTGCAAATGCTTCATCCAAGACACCAGCCGACATGCGA
AGAGCTTCTTCGCACTCAATCGCAGTGGTCACTAGGTTGGCTTCTTGAACCCGTGCAAGAAGCCGAAGTGTAAGTACTTGCACGTCCTGTAGGCCTGATG
CCGCATTCTGTTAACACGATGACAAATCGTTAAATTAAGTGCTCGCATGATGGCAAATGTGTGAAGAATGGAAACGTACTGAAGGTGCAGCCAAGCCTGT
GTCACCGTTGGAGCGTAGAACGCGTGTCTTCGCCAACTCAATAGGAATACTAGGGCGCTGTAACGATGACTCACGGTTTACGCTGTCGCGGCCTAATGCG
ATACGAAGCATGGATCCCACCCCGCCTTCCTGGGCTCGAGGCGATGGGATAGCGGTGGGCTCATTCGGAGCGAAACTTTCGCGCTGCTGGTAAGATGCCG
GAGACAAGATGCCTGCTGGTACCATTGTGGAGTACATATTTGCTGTTGGGGGTCCTACCGTAGGTGTACCTGGGGCTTGTAACAACGAAGAGCGTGGGGA
TGTGTAGCCACCAGCTCGAGGTGAATCCACAGCAGGATTTGGTGAAATGAGTGCACGAGGGACATCACTCTCAGCAACAGACGTTATTAAACGAAGCCCC
TGGGTTATCGCCTGACGAGTCTCCGCTGAGGTGGTATTTCCACGAGTCCCGCGATTCTGCAACTCCGCTGGGCTCTCGATACTACCTGTGGTGTACCAAG
TTGTGGCTGTTGATACTCCTGGCCGGGGATCAAAATGTTCAGATCACCTGGGTTCTGTGGCGCAGTGACGATAGGAGGCGGTGCGTGGCGACCTCCGATA
CTACTTCCAGGGGCTCGAACCTGGAATTCATAAGTCACAAGACCACCTCGAGATAAAATCAAGGATATCCGGGACCCCGACGTGATCCGAGTGCTGGATC
CATGAATACGCACACCATTTACAATAGTACCGTTCTTGCTGAAGTCTTGAAGCTCAAATTGCTCTTCACCTCCTTCCATTTCCCGCCGTAATCGACGCAA
ATGGAAGTGGCGACCACTTACACTGCGATCGTTTACAATGAGATCACAAGCATCCGCGGCGCGACCAACCCGTATTATAGGAGCCGTTAGTGGAAACGGT
GCATAATCGATGGCCGAATGCCCAGCAGCACCAACAGCATGTCCGTGCTCATTTTCACTCAATGGTGGCAGGGGAAGTAGTACACCCCATGCCCCAAATG
GAAGATCACCATCTCCTGATCTGTTGGGCCGCTGTGCAGCCCCACGCAATGCGCTCGATCCGAAACCAATTGGAGCAGCACCCGCAAATGAGGGGTGACT
TATCTTACGGCGCGGTGACTGTATGGCATCTATTCCCCAGCTTAAAGCATTTTCGCTCCCCAATTTTCGAATAACTTCGTCGCGCATTTCATCTTCGTAA
TGATCCAAAGCAACATCGATCACCTCCTCAGTATCCAAGAATATTTGTCGCTGCTTTACGCATAGCCATCGTTTTTGGAGAGCGCGTGCTGTTTCAAGCA
CTACTACGTCTGACTTTCCTGCCCACGACATCGAGTTCTCAGAGGAAAGCAACGTGACCACGCTCGTTACGAGCTGTGAGTCCAAACTCATTAACGTAGG
GCTTAGAGTTGTAATCTGCTTCAATAAGGATGACAACGCCTTTGATGACCTCCATCGCATTTGCTGTTTGTACATCTTGAGTCGTCCCCTCAATATTTTC
TGCACCGAACTGTTCTGGGGAAGTGACAAATCGTAGTGCATAGTACCCTCTTCATCAAAACAAGAAAGTGAAGAAACCATCTCCGATAGCGTCGTGATAA
TGCTTTCTACATCATCGAACATGTCCACAAGAGCTGGGATGCGCTCGACTACCTGGAGCTTGGAGAGTGGGAATGTCTGAGTTCGTGTATCTGGTGCAAT
CAACGGAGAAATGGAGTTTTCAGGACTGGAATCCACAACTACATCTGCTAAGAGATCTGCTGTGCGTGGATCTCTCGTGATTCCGGAGAGGACGCCCGCC
CTGCTCGAACCTTGGTCCCCGGCGCCTTCAATGGTGACGGATCCGCTTTCTCTGAACATTTCAATGTGTCCACCAACAATGCTCACTGCCGCAAAAACTG
TAGCCAAACCCTCAAGTGCATCTTTGGCCTTTTGCCAGAGCATTAGCGAATGCTTATCTCGAGTAATTGTCTGTGCTTTCTCCGTGTCATTAATCGAGTC
GTCGGTTTCTGGCGACGAAGTAGTCGACTCGGGTTTTCTTAGACCCGTGGAATCATTCTCTTCCTGGAGGCCATCAAGCACTGCGGTTTGTAGAGTCGTG
GTGTCTGCTTCCTGGATATTTGTGTAATATGCACAAATGGTGTCCAGCAGCTCGCATACCTTATCTGATTTCGTAAGCCCTCGGTTGATGGCGGCATTGA
TCGCGACTTTCCAGGCTGGATACAGCGTAAGATAGCGCAGAAGTGCGACGGCCTCGGAAGCCTTCGCTTCTGCAACGTGAGCTTTCTCGAGTGCAGCTTG
CTGAATTTGACTAACCTCAGTATCATTCGCTATACAAATTCCCTTCAAACACCGTGCTGACTGGCAAAGAGCAGTATTTGAACACTCCAAGCCAAGTTCA
TGGGAGCAAAGACGAGGCCGGAGCAGGAGAGGAAGGCCCACTAACCCCATCAGCATACTTAGAATATCCCCTGAGAGGATGGGGGCAGCCTGCTGGGAAC
GGTAAATCTTGTTGAGCGCTGATACAGAATGCTGCGGGAATACTAGCATCGCCAGGCGAATACATATAGTTGCGGAAGCCAAGTCGGAGGAGTTCATTCC
ACTAATGATGTGGGTAGTCACCTCGGAGTTGGCTGCAACTATCGAACCTACATCAGTATTTGCCGAACCACACGCGAGAAGCACACTTAATATCTGGTTC
CTGTAAAAGTGGGCGTGGAGCGAATTGAAATCCACTCCCGTGAGAATCCCCGAGTCTGGCGAAGATAACGTAAACTTGGAACCAAAATACTGCAGTAGCC
CAACGCACACTCGTTTGAGAGATACGCTAGTGCCCAGCAAGCTAGGCCCTGTAGCCGTTGTAATCCCACTTGTGGCAACATAACCGGCATCATCAACTTG
CAGAAACTGCAGGTTTTCCAGCAAAAAGCGTATGAACGTGGATAGCACTGGATTCACACGATTGCTTGCTGGTGCTAGGTGGCGTTTAGCTCTTTCGCCA
GCATCTTGAAGGGATCGATACATTAAAGCGCGAGCCATAGCCCAACCAGCAGCGTGTAACTTCACCAATGGAAGCTTGCGTTGTGGGTAGCCACGTTTGA
T