Description :
From Genome Similarity Track
Location :
Scaffold_26:127135- 128409
Transcript NameFunction/comments
Albla_Nc14029900
Albla_Nc14029910
Albla_Nc14029920

Sequence
1274 bases(100 bases per row)
AAACCTTTGGACTTCTCATAGCAGCTGGTGCCCTTGCCAACCTCAATGCTGAGAGCTTAACCGCCTATAGTAGTGTCAACAACACAAAAGCCATGGCTGG
AGCAAGCAGCGCAACTATGGCTAAAGTATCACTTCCCATGCTCAAAGCGCGAGCCAACAATTCAGGTGGAAGCAACATGCAGCCAAAAAAAGGTGCAATG
GACGACGACACAATGGAAGACGCTTCGGGAGATGGAACGTCTTCTGGGTCATCTTCTTTGGACAGTGACGGAGAAAAGGTAGGTGAGATGGATACCTCCC
CACAGACACCTGGAAAGAGTTCGGCTCAAGCTGTCATCTCCTCCTTTGGATTTGTCACCGCGTGTGTTGTCATCTCATCGTTCATGAATTAGCGTGATTT
TCCTACTTTCTAGCAGTTAGGATACCTGATAATTGCATTTTCTCTTCAAATATAGCTACAAATTCTGCTTTCATTATCTGTCTTTTAATTGGAGCGCAAT
AAAAATCTAAAATCCTTATGAAAAATTCAGTGATCCTCAGGAGAGGTGGAATGCTCGGTAGGGTCGCTGTACGCTTCGAATTGACGTATTTACGATCAGT
ACAACATTATTGCATTCATCACTCGGCATTCCAGATGCGTGACCACATCAAAAAAAAAGTTCAGATTGCATTGCAAGCATTAGGGTAGTAATATATCACT
TGTGGCAGAACATTATCATATGGCGTGAGTTCAGTACTTAGGGTGATCTGATCCACACGCTTTTACCCTTGAGTGAATCATTACTATTTTCAAAAAAATG
AAAACCGAGAAGGGCAAAATTTCATTGGGCTCCCATACCAAAGAAACGCGCCTTTTTTTGTATTTATCGACAGATGTTACACACAGAAGGTATAGAGCGT
CTTGCGTATGTATGACACATGTACAGTTTGGTGGCATGACTCTCTCCCACAGAACAGAAAAGATCTCCTGTCCAATCTAGCTCATTCTCAAATCTTCTTC
GAGCCCAACACATCATCTGTACCAACCCAACCAAACTCACATTTTAAAATGAAAACTTTCGGATACCTCATCGCTGCCATTGCTCTCACTCAGGTGAACG
CCCAATCCGATGCGCCCGCGATTCCAGCCTCTACACCTAACTCAGGCGCACAAGGCCAACCAGGCCCCCCAGGCGCACCAGGCGCACCAGGCCAACAAGG
CCCACAAGGTACAAACTCGGAAGGCCAAACCCCAGTTGAAAAGTCAGAAGACCAAATGTCTCCAATGGGATCCC