Description :
From Genome Similarity Track
Location :
contig_38:127134- 140435
Transcript NameFunction/comments
g8706.t1hypothetical protein
g8707.t1hypothetical protein
g8708.t1hypothetical protein
g8709.t1hypothetical protein

Sequence
13301 bases(100 bases per row)
CGAACTGTGGACAAACTTTCAAGCAATGGGTGCATCAGTTCCATCACTTCACCATTCGATTCCATAAGTGCAAAACGACGCTCTAGTGCCGACACAAAGG
ACGGGTCACGGACGCTCAAATGACCATTCTCCACAGCCGACGCCATTTTGTTCATAACCACTCCAGAGTTACCTGATCCAGCCTCAAAAATTTGCACAAG
CTGTTCTGCAGACAAGTTAATGCCCAATCCTTCGAGGAAATCAACGTTTACCAGCTCAGGGCACGTCTCGCAAAGGAAGCGGGCTGTTTTACTCTCCTTG
AAACTCCACTCTGCAGCAAACAATCGGACCAGTCGGCCAACCTCCACGAGCTCCCACCGCTCTCGGGCGGCCGAATCAATGAGACGAGTATACAATGATG
CGTTGTGGCCATCGTTGTGGTCGATGTCAAAGTCACCACCTTCATCGCTATCTGAAGAAGATTCATCCGAGAGTTGAATAACTGGAGACGCCACAGCTTT
TTTAGCTGGGTAGGGAGTCACCAGCTTTATGCACTTGTTTGACGGCAACTTGAGGTTGCCGTGGTCCTTCGTGGGCAGGTAAGAACATGTCATCTTTCTT
CTTCGCGTCCTCTGCAAGAGAAGCCGCAATCGGTGTCAATTGTTTTGTCGAAGCTAGGGGCTCCTCCTCAACTGCAGCAGTGCCAATTATTTTGCTGGTT
TTCGCCTTCTTGGAGGCAACTACAGGGGCACGACCAGATGCATTTGTCGTGCTGGCGATTGACGTTCTGGATCATCCGACACAATCAAGGTTTTTCCTCG
TCTTGGCTGCGCTGGAGCGAGCGTCTTGGGTGATACGCTGTTCAAACTCGTTGCTTCGGGTGACTTTTTCCGTTTTTTGCGAGACTTCGGTGAAGGTGCA
GGCGTATCCGATGGTGAGGTATTTTTCTTTATCAAGTCGGCGCCCGCACTCTTTGCAGTAACCGCGGGTAAATCATTTTGGACTCCCTTCGAGTTTGATG
CCGAGGATCCAGACGTATGGTTGCTGCCACAGGTAGCCTTCTCTCGAAGTTCTTTGCGTTTTTTCTTCAATTTCTTAATCTTCGTCTTGGATGGATGTGC
ATGAGGGTCGCTGCCATTGTTGCTGTCGGTAGCAGGTTGCAGAGCATCATTCTTCTTCTCAAAAGCTCCAACACTCTCCTTTGCCTTCTCCATCTTCGAA
ACAGCAACGGCCTTGCGCGCCGCACTCTTCTGCTTCTTATGAGGCGGTTTGACTATCTGCTGCGTAGCAATCTCCTTCATCTTTCTCAAAGCCTGCTCCA
ACGGATCCACTCCATTGTCTTCCTCATGATCTTCATCCTTCTTCATCGCATGCCACGGCGCCTGCACCGGCACCTTGGTCATTTTCACCGCCTCCACCGA
ATCCTGCTGCTTCTTCTTTTTCGTCTTCACCTTCTTCTTCTTCACGTCTTGGACAACAAGAGCAACAGTTTTCTCCTGCTTCTTAACGATGGCGTTCGAC
ATACCCGGCACGGTCACGACTCTCGCCCCAGCCGCCCCCTTCTTCTCCACCACTTTCTTCTTCTCCTTGGGCTTCTTCTCCTTCTTCACTTTGTTCTTAA
CGAATTTCACCATTGGCACGGGCTCTCCGTCGTCCGCAAAATTCTTCTTTTGCTTCTTGTGCTTGGACTTGAACAGCACGCGGGGCGTCTCTGGGGCCAC
TGCAGTTGCTTCTTCCTGCGGCAGCTCGAACATGCGCGCGTGGAAGGATGCCAGCCGCTCGCGTGCATCATCATCACCGCCTTGGAAGCTCTCGGAGCGC
TGGCGCTTGCGCTTCATCTTGGCCAGTGGAGCAATTGGCTGCGACCGTTTCGATCGTCCGAACCAGCAGCTTTTAAGCCAATGATAACGCAATATTTATA
TTTCCTACCCAATCAGATGGCTAGTCCGAAAAAGGCAACTATTAACTTGGAAAATGAGACCGTCGACGCTGACGGTGGGCTGGTGATTTTGGCCACGTGC
TGTGCTTTAGGCGTGTACGGGAAGCACTCGCGATACACTGAGAAATGTGGCAGGAAGACCAAGCAAGATCGTCGAGAAATGTTGCGCTCCAACCGCCGCA
GTCGCAAGGACAAACTGCTCAAAGCCAAGAAGCTCGCGCGAAGTGAAGCGGTGGTTGCTGAACGGGCTGGGATGACGGAGGAACAAAAGTGCGAGCAGCG
AGAACGGATCCGCATGCAACGTGTGGAGCAATACGTGAGTTTTTTTGCAGTGAAATAGTATGTTTGAGTTGATTTGGGCACTGAACTTCGTTGTGTTTGT
GCAGCAAAAGCTGGAGGAGGCTCAGTTGAGTGGCATTCGCGTGGTGGTTGACTTGGTGTTTGCCGAAGACCAGACAACTCGAGTGAGTTTCACATTTGAG
ATCTGGTGATAAAGTTGTTGTTGTTGCTGACGAGCTGTAATGCGTTAAAGGAGCGTAACAGCATTTTCAAGCAGCTCGGTGTGTGTACGGGTATCTGAAA
ACTTGTCCGCTAGACAGACTTCTGTCGCTGCATCTCGCCTCCTGTACGCAAAAACTTGCTGCCGTTTGCGCTCAGCACGGTGTGCTACGTTGGAAGGTAT
GGATTATTGTGACCTTGTGCTGCAAACTTGTGGGCCTGACCATGCTTTGATGCAGGTCGGAAGGCACGAAGAGCCTCTCGAGCAGCTGTATGACGTCGGC
GAACTCGTATACTTTCACCGGACTCGGATAACGTGCTTAAAACGCTGGATCCAGGCTGCGTGTATGTCATCGGTGGCATCGTCGATCGATCAGTTCGCAA
GGTACTTAGCGTAGCCACTGAATTCTGATGATAACCTACGAATTTGCCAGCTCATCCGTGAAATTGATGGGTTTTCTACAGGGCGAGACGAAGGCAAAAG
CGGCTGCGCATGGCATTCAAACTGCACGATTGCCACTTCAAGAACACTTTGAACAGACCGGAGCACGAGTTCGAACTCACATCATGAACCTAGATTCTGT
GATCATTACGCTGAACGAAGTGGCAAATCATGGCGATTGGGGGCGTGCCTTTCGGAAAGCGGTGCCGCTACGGATCTCTCGCTCAAAACAAGCTAAGAAG
AATCGCGTGGAGAACGATGCTTAACTCGGGCGCTGGTGAGCGTGTGCAAATGGTGGGAACCTTAGTTAACGTGTTGATTGAAAAATAAAATATGAATATG
CATCCTCATATCGATACAACGAGGGGTGATCTGCTCACTCTCCAACCATGGTGGCCATGCCAGCAATCACGCTTGAGACTGCAGCAGTTGCCGTAGCTGT
AGCAGTGGCGGCAGCATTGGTCCAGTTAATGCCTTGGCCAGCTCGTTGAGCTACCGTCGTATTGTCTGCATCGATAGACTGGCAGTGAGTGATGGCGTAC
ACGAGTTTATCGTGCATGACTTCACGACACGAGTACGACGGCAGATCGATGGAAAAGAAACCTGCAATACAACGCCACAGCGTTAGTATGGCGCATTCAC
GTACAACGTTATTGGGAAGCATAGCTTACAGGTATGAGCGATGGGCAAGTACATATCAGCACGACCCGCAGCCTTCGGGAGACCCGAAATCTTGAAGTCC
TGCGTGAAGTCTGCTGCATGTGTAGGCAAACGCGACCGACCCCTGTAATAGGTAAACAGAACAACAGATTAGTGCACTGAATAACCAAACCAAACTTAAA
TCTGGTGGCTCTTACCAGACGAAGCGAAGGAACGATGATTTCTGCTCGGCGGTGAATTCTGCCAAGATGTCCCAGAAGTAGGCAATATGCGGGTCTGTTG
CTAGACAGCCGTCGCCGTATATGGTTCGCCGCCGTAGAAGAGCAATATCTACGGAGGCTTTGCCGCACACGAGTGTCCGCAACTCATGCCACGAGAATAG
CCCCAGAGTAGGTGCTGGTAGAATCGTTGCTATACCACGCGAAATGTCCCCACATACTGGCGCGAACTCAGTAAGACGGTATGTCTCGACTGCTGATGCG
TACTCCTCACGATCTTCCCACGTAACGTGCAAATGCTGTCCCCCAGGCACTAACTCAACTGTCTCCCGCGTACTGGATAGCACAGTAAAACTTGCATCCA
CGATCTCATCGAACATAGTCTCCGTAATGCCGTGTGCATCCAAGTTCGCAATCGTGTCCACAACCTGAAAGCATCCCTGATGGACAGCTTCAATATCGTG
TCGTGTTACATTCTGCCCTACCAATAGTTTCCACACCACGGGCGGAAGATTCAGATCCAATGGTGTTTTAGTTCGCACAGCCACTCCTGCAAGTTTGCCG
AGGAACTCGGCCATCTGCACCCGTCGCGGGTTTGAGCGTAAGTGTGAGTTTGGAACGAAAAGCTCACGGTTTTCGCCCGTGTTCAGCAATGCGTTGGGAC
ACTGTCGAAGTACAGGCAGCAATGGCGTACGGGTTTGCAACTCGGAGCTCAGCTGTGCCAAACACTCGCGGTACAGACCGCCGAAATCGTCTCCAAATTC
GCCGACAAACTGGCACTTGAATGCACGGTCAGCCCCACGTAATAGAGCAGGTTGCAGTCCGTGAAGTTGCTCGAAAGTCTGGGCGAACACACTATCCCGC
TCACCAGCTTCGCTAGACAGCGGATCACCACGCTCCGATAGTTCCAGTGCATCATGAGCACGGTTGCGATCGACTTCAATCTCTGGACGAGCTGCTGCTG
GAGCTTGCTGCTCTTTGAGGACTCCGAGCCACCACGCAAGCTTCACGTGCTGAAAGACCACACCACGAAGCTCTCGAGCCCCACGAGCTAGCAATGAGTG
CTCATCCTGGGCTGAGAAGTCGATAAATGCCAGTGATGTCTGCAAACGGCAGTTGAAGTTACGTAACACCAAAAATCGGCGTTGGAGTGTCTCCAAGGGT
ACGCCTCGCAGTACCGGGAATCCCTGTAGTTGCTCTTCGGTTGGAACAAACTCCTCGGGAGCCATACGCAGTGGGTCACAGCTTAATAGCGCCTCGGCAC
GAGTCTCGCATATTTCGTTTACGAGCTGCACAAGAGCGCGATCCCGGGCTGGGGTAAATACACGCTGGGATGCGTGCAGGTGGCGAAGCTTATCACCGTA
CTTGGTCGCTAGTAGCCGGCGGCCTGTTACTGAGAATTCTGGGACGGCAGTGAATGCAACACCCCACTTGGTGTCTCCGGACGACTGCTGTTCCTGCTGT
TGCTGCAATAAACTCGTCACATCACCAGTAACGACCTCTTCAGCGGATCGAACCGCGTCAGTATCTCCCTGAGCAGAGGGCGGAGGTGGAATTGTGCTTG
AATCCAATGCTTCACTTTCTAAGTCCTCAGACAGCGATAAGGATTGATCATGCAGTAATTGACGGTGCCGTGCGCGGCGTGCCATTGCTTCTGCTTCTTC
GCGAACGAGTGCCTCCATTGCGTGCATGTTCGCCAGAATGAAGTCAGCAGCCTGCTCTGCATCGTCTTCACAGTGGCGGAGCGCGTAGACGCACCATTCC
ATAGGGAACCCCATTTGGCTCAACGCAATTCCCAATTCCATTCGGAAGTTTGGAATTGAGCCATCACCCAGGCTTCCTTCGCCAGCAAATCCACCGAGAG
TGTCTTCTTCTTCTTCACTGTAGTAGGAATCCTCCCCACTCGCCAGTCCGCTACCGGTTCGAGGTAGTCCCGGTTCAAGACCCCCATCCTCGACTCGGTG
TCCACCGATAAGATCGATGGAGTCTCGCTGGTTGTACAATGCAAATCCAGGGTAAAACGTACCCTCAAGTTTAGGCCCAGTTCCACCAGGACCAAACGCA
ACACCCAAGTCCTTTCCATTGAGTGCGTAGCTAAGCGTACCGCGCCGCAAATCAAGCGTGAGGCGGACAATATCTCCAGTCTTAAATTTGTCGCCGTATG
TACCACGCTGCTTGCTGCCATTGTGCCAAAGCGCACGATTGCCAATCCAGCCCCACCCGCGGTTATCTTTGCCCAAGTAGGAGTCTAAGCGTACGTCGCG
ACGAGCAATCCCCAAGAAGATATTTGAGCTTGCTGTCACAAACGTAATGCGTACTTCCCAAATGTGCACACCTCCATCAAAACGCGCCACACCAATACCT
GTTTGCCAGCCTTTATCACGTGCGAGAGAGAGCCGAGTGTCTCGTGCTTCAAGCTTAAGATATGGGCCTTTACGCACACGATCCACACGACACTGGAAAT
TAGACTGCACGGGGAACCGCCACACAAAACTGTCTCCATCGATGGTGACTTCCTGCCCTCCGCAGGCCCCTGTAAATGCACGCACTTCTGCTTCGCCTCC
TCCGCTGCCTTCAGTGCCTCCTTCACTTCCAGCAGCATTTCCACCCTGCAGGATCTGCAAGCAATGAGAGCTAGCTGTCTCACTCTGAGGGTCTAACCGC
ACGCGAATACTGGTAGCAAGCGGGATACTGACGAGTGACTCTTGTAGGTCGAGATCGTATGGATGTGCACTCTCTACGCGAATACACACATCCTCTGAAA
TGTCTGACAAGAAATTGTCAGCCGAAAGCATAAATTCATCGGGTAACTGAGCCTCAATGGCAGGGTCACTTGGTGTCCCTGTCTTCTCACCATCAGCGTT
CACTTCATCAGACCTCGCGGGATCCATTAGCGCTTTCATCACGCCATAAACTTGACTCAGAGGCTCAAACCACTCGAAAGCACTCATAAGATTATCACAG
TCAAGCGAGTGGAAGCGGAAACTGAAGTTCGCGTTCTTCACTGAAGCTGTCGCTGTGGCACCCAGGTTGGCGAGCAATTTGCAGTCTGCGTTGAAAGAAA
TGGTAGGGTGTAGCAGTTGTGGTCGTGAAATACTCGAGAATGCAGTACCCAGCAGCTGGCCATTCTTGCAGAAGAAAAGCTCTTGAGTATCTAGGCGCAA
ACCACAGCCAAAAACATCACCAGGGCTTACAGCACCTGCAGGTTCAACCCAGCGCCAGCGATCCACAAGAGTGTCACCAGCACACAACGCTTGGCCGTTT
GCTGGAGCAAAAGAGTAAGATCGAGAGCCGTCAGCACTGCCGCCCACCAATACTCCTTCAAGTGGGAACGACGGTGGTGAGAAACCCAGCGCGAGCGAGC
CTCCCATTGTAGTGCTTGTGCCCCACTCCACGACTGTGACTTCGAAATACACAATTTCGGCTTTTACCTCATCTCGCATTGTCATCATGAGAGCTGGGGT
ATGTTCGAAGCGGCAAGAGTACACCTCTCCGGGAGGAACACCAAGTCCTTCAGCTGCCAACGCTTCTCTCGCCGCCGTGTTGCCGCTGTCTTCTGCGCGA
TAGTCTAGCAAGAATTTACGCTCTTCGCCAGATAAATGGCGACTGACCGCCATTTTGGAAGAATGGCTCACCAGCATCTCCACGAAAGGCTGTTTGGAAA
AATGGAATCGGTACGGTAGGCTCAACGAGCCCCCTCCATCTCGTTCTAAACAAGCGGCGAGCTCTTGTATACGCACACCGCGTTGCTGATCCTCGACAGC
AAGCATCAACTCTACAAACGCCTGCAAAAGAGCATGTAACGTAAATCCGCCGTCTTGGTCTTGGCTCAAAGCCATAATCTTGGAGCGACAATAAAGTAGA
GCTTGCTTGTCATACCATGTGCACCACGCTGGATCACCGTAATGAGACCTCGTACAAGTGCGACTGCAGCCTGCCCACTAGACGGCTGGTTTTCACGCAG
AACTTGCTGTACGAGAGTAAACAGAGCCGCCGGCAGTTCGGGGCGTAACCGTATTGAAGTATTTTGTTTCGCCGGCTTGCTAGATAGCACCCGCTGATAT
TGCAGTAGCAGCTCTAGGAAGGCGAGCACATGGTCCACACTTATTGGTGCACACAGAACCAAGTCTTCATCTGAGAGACTCACCGCGAACGCCGTGCTGG
GTTCAGCAGCGCTAGTGTCATTCAGTGTAACAACCGGTAGAAGCAAACCAGTGCTAAACTCCGACTCCACTGCCCAAAGAGACGTTTGAACAACAACGTC
GTCAGCAACGGGCAGCATTAGCTGCATTCGAGAAGAATCAATCGCCTGGTTCTTGGTGTTACGACTATGTGGGGTCGGACCATTCTCGCCGGTGGCATCT
TCTTCGTCTTGAGCTTCATTCTCGACTTCAATCGTCGTCGGAAGCTCAACACCTCCACCCCCTGTGGAAGCAGGTGAAGCTGCACGCCAAACACAGTGAA
ACGAATTAACACGTTTCACAAGGTCTTCGCGAATACAACGTGTGCTGGAGACATCTGGAGGCTCAAAAGGGTCTTCCTTGCTTCCTGCTACGCATCCTAA
TGCTACGTACCCAGCTGGTGCAACAGGCCACCAGATAGAGCGCAGCTGCTTGCGTTGAAAATCCGGATCACTTTCGGAGTTCTTAGGCAAGCCTTTTCCA
GTAATATCCACACGCTCAAAGCTTGTAGGTGGGGCCAAAAACTCTTGCTCATCGTTATCGTAAATCAGTAGCATTGGTGCATCAGGAGCACCGTTACCAC
ACTTCACCACATCGCCAAGGCAGAACCATTTATTGGTAGTGTCCGATGCAGCCTCCGGCACTGGAGGTAGCGTCGGACGCCAAATTGTCACTGCATGATC
TGCAGCAGACTTCATCCAGCTATTGTCACTGCCGAGTGAAGACGCGAAGCGTTTTCTCCACTTGTGGCGATACTTTAGTAGTGGGTCAGGTGGTGGAATA
CTCCACAAGCGCTCGTATGTGTCAACCACCATGACTTCAAGGCCGCAAGAAAGCAGCACAGGTCCCTTCGGGAAGCACCGTCCGTTTTCCGATTTCGAAG
AGGCGAACTTTCCCACCCCAGTGCAGTGGCTGGTGTCGCATGCGTACGCGAAAGAACATGCAAGATCGTTTCGAACGTGATTGCATCCAGTGTGTTGGGC
TGGTACAAGTCATTGACATCCTCTCCAGCGTCGACCCTGTTCTGATCATTCTCAACAAGGGATTCAACAAGCTGAGTAATGCCAGACCAGCCTAGTTTTG
CAGGGTGTTCCATGACTTGGTCGATTGATCGCTGCACAGTTGACAAATTTTGTGAAGAGAGCAGGTTTGATACCAAAGTTTCTGTTGGAGAGCGTGCCAT
CACTTCGCGCACCATGCGCGATAGGATCTGCTGAATCTTGCCGTTCTTTTGCGCCTTCGGTTGTTGATGCAACTGATACTCTGTTTCGTGCTGCAAATTC
AAACTCGCTTGATGGGGAACGCTCAAAAGCGTAATCAATCGCCGAAGTACCAAAGGATTCCCAAGATCACTGAGAGGTGCGTCTCCGGTCTGTGAGGCAT
TTCCGAAGAGCCGTACAATCTGGACAAGAATTGTGCGTGCATGAATAGCTGCGAGGCGCTCACATAGTATCTCTTCTTCACGATCGATCTCAAACGCGTT
CATTTGTCGTACCGCATCGTCAAAACTGCTGTTGCATTCGCTCCAGAGCGTTAACTCTGATTTGCTGAGCATCAATTCCAAACCGGCACCACCAGCGTTA
TCCATCTTTTTGGTTTTAACAGGACTTCCCATCGCTCTGCTAGCAGCACGGGGAGGCACAGGAGGGCACAGTGCACTGGATTCTGTGAGAGCGTAGCTTG
GGTTTTCGTCTCCGATGTCCTGAAAGTTTACCAGCGGCTCACTAGGCTGTTCCGCAAGTAGGGTGGCATCCGTTGTAGTGAGAGATCTGGGCGATGACAC
TGAATTTTCCAGTTCTGCACTTCGGCTTGAAAGTAGTAAGCGTAAAGCATCGCCGTAGCTGTTATCTGTTTGGCGTAGAGCTTCAGCGCACACTGACTCA
GATCGACCAATAACCATTGCTAAGTGGCGCACGTTTGAAGGGTAGCCACGCTGTGCGGTGTTGCAAAGTTATAAAAGTAAACGTTAGACCTATCATCATA
TGCACTTCTCGCAAAAATACTATAACAGATACTTACCAAGTGAAGCCCACGACTTTGCTGAATCACTGCAAATGCTTCATCCAAGACACCAGCCGACATG
CGAAGAGCTTCTTCGCACTCAATCGCAGTGGTCACTAGGTTGGCTTCTTGAACCCGTGCAAGAAGCCGAAGTGTAAGTACTTGCACGTCCTGTAGGCCTG
ATGCCGCATTCTGTTAACACGATGACAAATCGTTAAATTAAGTGCTCGCATGATGGCAAATGTGTGAAGAATGGAAACGTACTGAAGGTGCAGCCAAGCC
TGTGTCACCGTTGGAGCGTAGAACGCGTGTCTTCGCCAACTCAATAGGAATACTAGGGCGCTGTAACGATGACTCACGGTTTACGCTGTCGCGGCCTAAT
GCGATACGAAGCATGGATCCCACCCCGCCTTCCTGGGCTCGAGGCGATGGGATAGCGGTGGGCTCATTCGGAGCGAAACTTTCGCGCTGCTGGTAAGATG
CCGGAGACAAGATGCCTGCTGGTACCATTGTGGAGTACATATTTGCTGTTGGGGGTCCTACCGTAGGTGTACCTGGGGCTTGTAACAACGAAGAGCGTGG
GGATGTGTAGCCACCAGCTCGAGGTGAATCCACAGCAGGATTTGGTGAAATGAGTGCACGAGGGACATCACTCTCAGCAACAGACGTTATTAAACGAAGC
CCCTGGGTTATCGCCTGACGAGTCTCCGCTGAGGTGGTATTTCCACGAGTCCCGCGATTCTGCAACTCCGCTGGGCTCTCGATACTACCTGTGGTGTACC
AAGTTGTGGCTGTTGATACTCCTGGCCGGGGATCAAAATGTTCAGATCACCTGGGTTCTGTGGCGCAGTGACGATAGGAGGCGGTGCGTGGCGACCTCCG
ATACTACTTCCAGGGGCTCGAACCTGGAATTCATAAGTCACAAGACCACCTCGAGATAAAATCAAGGATATCCGGGACCCCGACGTGATCCGAGTGCTGG
ATCCATGAATACGCACACCATTTACAATAGTACCGTTCTTGCTGAAGTCTTGAAGCTCAAATTGCTCTTCACCTCCTTCCGTTTCCCGCCGTAATCGACG
CAAATGGAAGTGGCGACCACTTACACTGCGATCGTTTACAATGAGATCACAAGCATCCGCGGCGCGACCAACCCGTATTATAGGAGCCGTTAGTGGAAAC
GGTGCATAATCGATGGCCGAATGCCCAGCAGCACCAACAGCATGTCCGTGCTCATTTTCACTCAATGGTGGCAGGGGAAGTAGTACACCCCATGCCCCAA
ATGGAAGATCACCATCTCCTGATCTGTTGGGCCGCTGTGCAGCCCCACGCAATGCGCTCGATCCGAAACCAATTGGAGCAGCACCCGCAAATGAGGGGTG
ACTTATCTTACGGCGCGGTGACTGTATGGCATCTATTCCCCAGCTTAAAGCATTTTCGCTCCCCAATTTTCGAATAACTTCGTCGCGCATTTCATCTTCG
TAATGATCCAAAGCAACATCGATCACCTCCTCAGTATCCAAGAATATTTGTCGCTGCTTTACGCATAGCCATCGTTTTTGGAGAGCGCGTGCTGTTTCAA
GCACTACTACGTCTGACTTTCCTGCCCACGACATCGAGTTCTCAGAGGAAAGCAACGTGACCACGCTCGTTACGAGCTGTGAGTCCAAACTCATTAACGT
AGGGCTTAGAGTTGTAATCTGCTTCAATAAGGATGACAACGCCTTTGATGACCTCCATCGCATTTGCTGTTTGTACATCTTGAGTCGTCCCCTCAATATT
TTCTGCACCGAACTGTTCTGGGGAAGTGACAAATCGTAGTGCATAGTACCCTCTTCATCAAAACAAGAAAGTGAAGAAACCATCTCCGATAGCGTCGTGA
TAATGCTTTCTACATCATCGAACATGTCCACAAGAGCTGGGATGCGCTCGACTACCTGGAGCTTGGAGAGTGGGAATGTCTGAGTTCGTGTATCTGGTGC
AATCAACGGAGAAATGGAGTTTTCAGGACTGGAATCCACAACTACATCTGCTAAGAGATCTGCTGTGCGTGGATCTCTCGTGATTCCGGAGAGGACGCCC
GCCCTGCTCGAACCTTGGTCCCCGGCGCCTTCAATGGTGACGGATCCGCTTTCTCTGAACATTTCAATGTGTCCACCAACAATGCTCACTGCCGCAAAAA
CTGTAGCCAAACCCTCAAGTGCATCTTTGGCCTTTTGCCAGAGCATTAGCGAATGCTTATCTCGAGTAATTGTCTGTGCTTTCTCCGTGTCATTAATCGA
GTCGTCGGTTTCTGGCGACGAAGTAGTCGACTCGGGTTTTCTTAGACCCGTGGAATCATTCTCTTCCTGGAGGCCATCAAGCACTGCGGTTTGTAGAGTC
GTGGTGTCTGCTTCCTGGATATTTGTGTAATATGCACAAATGGTGTCCAGCAGCTCGCATACCTTATCTGATTTCGTAAGCCCTCGGTTGATGGCGGCAT
TGATCGCGACTTTCCAGGCTGGATACAGCGTAAGATAGCGCAGAAGTGCGACGGCCTCGGAAGCCTTCGCTTCTGCAACGTGAGCTTTCTCGAGTGCAGT
TTGCTGAATTTGACTAACCTCAGTATCATTCGCTATACAAATTCCCTTCAAACACCGTGCTGACTGGCAAAGAGCAGTATTTGAACACTCCAAGCCAAGT
TCATGGGAGCAAAGACGAGGCCGGAGCAGGAGAGGAAGGCCCACTAACCCCATCAGCATACTTAGAATATCCCCTGAGAGGATGGGGGCAGCCTGCTGGG
AACGGTAAATCTTGTTGAGCGCTGATACAGAATGCTGCGGGAATACTAGCATCGCCAGGCGAATACATATAGTTGCGGAAGCCAAGTCGGAGGAGTTCAT
TCCACTAATGATGTGGGTAGTCACCTCGGAGTTGGCTGCAACTATCGAACCTACATCAGTATTTGCCGAACCACACGCGAGAAGCACACTTAATATCTGG
TTCCTGTAAAAGTGGGCGTGGAGCGAATTGAAATCCACTCCCGTGAGAATCCCCGAGTCTGGCGAAGATAACGTAAACTTGGAACCAAAATACTGCAGTA
GCCCAACGCACACTCGTTTGAGAGATACGCTAGTGCCCAGCAAGCTAGGCCCTGTAGCCGTTGTAATCCCACTTGTGGCAACATAACCGGCATCATCAAC
TTGCAGAAACTTCAGGTTTTCCAGCAAAAAGCGTATGAACGTGGATAGCACTGGATTCACACGATTGCTTGCTGGTGCTAGGTGGCGTTTAGCTCTTTCG
CCAGCATCTTGAAGGGATCGATACATTAAAGCGCGAGCCATAGCCCAACCAGCAGCGTGTAACTTCACCAATGGAAGCTTGCGTTGTGGGTAGCCACGTT
T