Description :
From Genome Similarity Track
Location :
Scaffold_58:127132- 136125
Sequence
8993 bases(100 bases per row)
GATGGTATCCCACTGAACGAGATATAGAATATCTTATCGGGTTTATAGGGTCAGCCACGAGATAGGAAAGATCTTAAAAGATATTAATTTAGGACATGAG
TGCCTAGACTAGGTAATATTAGGATTAAGATATTCTATAGAGTTAAACGTAAATAAAATTCAGTTCCCCTTTTGATCTTGTCTAAGACACGTGCCGTACG
AGGCGTCTCTGATCGTTGATCGTTAAGAGTTAGCAACACCTCCCTGAGGTAGTTACTCTTGAGCACTACGTGCTGTAGCTTCACTGAATCGTTCGGTCCC
CTGGAACAGGGACCTTAAGTTTCACGCTTGTTGACTCATAGAGTCTAGTTCTTCAGAACTAATAACGCTCTTTGAGCACTAAGTCTTCCTCTGACTTAAG
GAGCTGTATAGCTCCGCTACATCGCCCCTTGGTATAAGCAATGCAGTCCAAAGAACCTAATCAAGTTACAAAAAACTACACAACAGCAGCAGTCACTGAA
GAATGATTATGATGTTGTTAATGTATGTATTAAACCAGTACAGTATGGTAGTGCAACGCGATTGGCCTGTACTTATGAGCGTTCAGTGTTTGCTTACGTG
ATCATATTCACCTTTGATCGATTTTAAGCCAATCGCGTGCGTGCGTCACAATAGTGGCCTAGCCAAAGAGTGACTTCAGATATGCCTATATACCTATGAA
GGGGACAGGCTAGATCGCACTTAGTAAGTGTAAGGTACACTTGACCGCGTTATTTACAGACACACAGACAGATAGATAAGTACGATTTAAAAGCTGGGCA
TTCAATCTCGCGCACACTCATTAATAGGTTCACCCTTTAGGGTCGCAATAGCCACACTTTGTTGTGATTCTATACGAACTCATTTTCTTCGTCGTGTGAC
ATCTATATCGCTGTTTCTACTGATCTGTAAATGTGCATAAATGCCCTTCATCGCCACCATCTCTGTCTTTTTAGTCTTCTGTTTTCCCCTTTTTCCATTC
CATCTTATTTTTATTAATACATATTACTATCCTTGTCCGCTGAATGCCAGTCAAAGCTGCGCGTGACCGTCTTGTCGATTTTGAACATCGATAGGAGCAT
TTGCACTTAAGGGTTCAGTATTGTGGCCTTGAAGTATTGTCTATGAAGAAGTTTTAGTAGAAATAGTATACTACCACTAGACGTTGACGCTTTCTTATCC
ATATACTTAGAATTGTAGAATAATAGTGTACGCAAGAGCGTTGCCTCCAACTTAACTTCCGATGACATCGCCCTGTCTTAAGGTAATGGAAAGTGGTGGG
GCCGCTAGACCAACGGGCGATGCCTTATAGTCATAACAATAACTCGACTTGCGAGAGTATAAATGGGAAAATATGTATACTTAGCAACTAAATCGTAACC
AAAGACAACTTGTTGCGACATGCGCTTACTTAACGAAAGAAAAAGGGAGTGAATTTAGCCAAAAAGGGAGTGAATCTAACAATCCCCACTTTTAAAACCT
ACATTCTGTCGACGTCTATGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTG
TCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGCCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTG
TCTGTCTGTCTGTCTGTCTGTCGGTCTGTCTGTCGGTCTGTCTGTCTGTCGGTCTGTCTGTCGGTCTGTCTGTAAATAACGCCTGGTGTACTTTACTCTT
CGCACTAAGCGCATTGTAGTATGTCCGTCAGTAAAGCTCGATACACCTTATACGTCGTATTAAGTGCGGTGTCGCATGTCCCCTCATTTGTATGCGTCTG
CCAATAAATGCTCGGTGTACCTTACACGTCGTACTAAGTGCGATGTAGCCTGTCCCCTCATTTGAATATGTCTGCAAATAAACGCTGGGTGTACCCTACA
CGTCGTACTAAGTGCGAAGCGGCATTATATTTCCTCGTCATTTGTCAATACGCATTGTTGCGAGCCTGAAGAGTGAAGCTACTAGCGACAGAGCGCAAGG
TACGTGAATATATAGAACTTGATTCAGTTAGATGGACTGAATTACGTATATCAAAGGGCGGGCTCCAGAGCTCGGTCCCCTATCGTACAAGTTATGCGAG
CTTGAACGGAGAAGCTATGTGACTGTGCACGAGATAAATACCGAACTTTTGAAACCTACATTCTGTCTATGTCTGTCTGTTTGTAAATAATGTCTGGTGT
ACCTTACACGTCGTACTAAGTGCGATGTAGCCTTTCTCTGATCCAAGGTACTACATGCGAGCGAGAGTCATACAGTAGTACGACACATTAGAAAAAAGCT
GTTCATGAGCCTTCACCGATACACCAACCGCCTCCGGCGTTGATCGATGAGGAAGGGGAATTATAGTTTCACGTGATATCTGGTGAAGAGGCGCGAGAAT
CCTCAGTCCAGGAATCCATAGGCGTACGAGGTTACGTGTTTGCAAGACTGTCCATACACTGTGGATATGTTGGAACTCCATGGCGTATGTCAACTTGCAA
CTTAGGTCGTTTTCTACGAGTAATGGTGGGGACTGACGGTTCGATGAATGTAGACTCTTGGCTACATTAGTGGCCGAAGCACATTGATGCTGGACTCTGG
GAAGCGCATAGTGAGATTGGAAAATCGATCGCAATTGTCCTCTGGCCTTCAGCTTCGCAAAGTCGTATCGAATCTTGCGTTCAAGACATACATCAGCCAC
ACTGACACTTGCTCGTAAAGCCATTGGTGCTCAAACGACGTGATTTATGCAACCATCGAAAAAACAAGTTGTCCTCCTCGACGTTCAGTTTTCCTGCGGG
CAAAAGAATAAGTACAACTTGATGGTAGATACTGAGACTCCACGCATCTTCTGCAACGGCCAAGTCTTGTAGTGACTCTGAGTCATACGGAACTGCTCAA
AATACCTTTTACGAAGGCCTCGCGTAATGCGACCTCGTCGGTATTCTAGACTCAGGACTTATAGTCCACGAAACCGAGGTTTGGCCATCCGTTTTTTTGC
CTATGCACTCTTCGACGATCGATAGCGCAAGTACAAACAAGAGTCATGCAATACCATTATCACAAACAATCTTTGCCGTAGAGCACTTTTCATTAGTCAA
GGGCTTCAAGAGTGCCAGTCAAAATCCGTTTGCTTTAACTTACTTCGCACATCTTCAAATATAAAGTATTAAAAACGTGTGATGACCTTGAGCATTCAAC
GTACATCCCTTTGAACTTGATATGTGTATGCTTGGTGTGACCGTATACTTTTGACCGGGTGCCAAAAGCGTTCTTTTGCCTGCGAGATATGCCACCACGC
AAAATGGTAACGTTAGCACTGTGAGGGAAAATATGACAGTTTTGCGCATAACATACTCCGATACAAGCACCAAAATTGTAAAGGTTGTAGAGCTATCAGC
ATAAAAACGGGTGACCGTTTTTTATGGCCTATACTTTAGTACAATTCATCTTAGTGTAGGGTACTCGGGGAAGCTTTCGTACCGTAGATAAATCACAAAT
AAAGTTCAGTTCACGTTTTATGCAGAAGAGTTAAAGTCCTTACAGAATTTTTGGATAGAACACATTGTGCTGCTAGGTCCCTCGGAAATACCAAAATGTT
TTTTGTGCGTATTGACTGTAGAGTCTTACCAAATTTTAAAATAAGTATACTTGTAAGTCGTTGATATTAGTTTGTTAGACTTATTGCCTGTAATCCTAAA
GCCTCTCTCTGACTAATCGGTGTGCATCGCGCTACACGTACCAGTAGCTTGGCCTTAGCATCATAAAGTCGGGCGTTAAAGGAGATAAAAAATTATCCAG
GAGTCTGGCAATAATTGTCTCCACCTAGTGCGTATTGCGTACGAGGATCGCAGAAAAAAAACTAGGGCGGGAGAGTTTGGCGCATATCCAGTCAGTGCTA
CTGTGGATATGTGGGGTCGAGAAAGAAGTGTTCAAGTTCAAGTGTAACGGGGTGAGCATGTTACATATAATTAACATCTAATACTTGTTAATTAGAATAG
TATAATAAAATATGATAATGTTCATGACTATTTCCATGTAGGGTAACATTCAGATGCACTCATTTTTTGGCTGATATGGACCGTCATATCAGTAAACTCT
AGCGGTCCAATCGGTGATGAACGCACGCAATGGGTGGTGAGCAAGACTCGAGTATACATTTTGTAGATAGATATAATTAAGTTAGGACTAACACAGGTTA
ATTATTCGGACTTAATTATATCTAATACAATTATATTTCTTACCTCTATCAGACGAGTGTTTGATAGTTAGTCTTCCTCTGCTCGTACCGTGTACGTGAA
GTGACGCGCGGCACTACTTACACTGTGTCAGCGTAAGTTACCAGCGCCCCGATACACCTGGTAGCACTTTGTAGACTGTCCAAGGACCGCAACCCCTGTA
TCCAACATGAACATTTTGGATGATGATGGTGACAGCTTTCACATCACATATGAAATCTACTCATATTTGAGTGACATAGAATGGAGTGCGGTCGAATGAG
TGGGTTTGACCATCGGCACATGCCGCCTGTGCCATGCTGTCCGCACTGGACTGAGATGAGCAGCATGTCACCGTCGCCAAATTCATACAGCATGAACTTG
ACGCGTCACGGGAAAAAGTAACAGGCTTCACCAGCAAGGTTCTCAACAGTTCGACTTGTTGAGACAACTGCAGGCACAGACTGCTGTTCCCGAGCCGACG
TACGCGCGTCGACCCGAAACCATGAAGATTGATATCTCCAAGTACAAAGGAGTCGAGGAAGATTCCCTGTTGAGATGGTTCGTCGAGTTTGACGACGACA
TAAGGGCTCGTCGCATCGTTTATGAGCATAAGTAAGTAACATTTGCTCAGTTTAGCATGGCAGGACGTGCCAAAACTTGGGTACTAGGTCTCAATTTGCA
CGACCCATACGTGTTTGGGTCGTTATAGGCCTCCAAGACCCGGCTCAAACAAGCGTTTAAACCGCTACAGGATGAGTTCAGGTGTTGATCAGAGCTCCTG
AAGCTTAAGCAGGGTAAGCGTGATGTGCACACTTACGCCCAACTATAACACTCCTTGAGAATTGCATAACGGTTAAACCGGTCCATGAAAACACTTAGAT
CACGGTGTCATGCAGGGTCTTGCGGTGGTCCCGTCAAGACCCACCTGTTCCGCCTGGAACTGGATACGCTAGAAGAAGCGATCTGAGTTGCGGAACAAGA
GGACTTTAGCATGAGACAGGCTCATGCTAGCTCACTTTCATATCGAACAAGAGACGAAAAGAAGTCGGAGGTCTAGAACCAATGGAGCTCTGCAGTGTTG
AGAGCGATAGACCTCGCACTTCAAGCAGTAAGCGATTGCAAAGTGCAATCGCTGTCAGAAGTTAGGACAATACGCCTACGAGTGTAGTGCTTCACGCCCA
GTGTCTCGCAATACTGAGCGAAGTGATCGACCGTTTGCCAAGAAGGGCAATGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTAGCAGACCGT
CCAAAATTGGTCAGGGTCAGCGTGGGCGGAGTGCCCTGTTGATCCAGCAACCTCAACAGAATTTGCAAACCTATTGATGAAAGTTGCTCCAGACTCACAA
TCCTTGTGTGTCTCTGCACTTGGTGATGAGGTACCCCTCCTCACCTTGAAGTTAGAAGTGACAACAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGG
CGTCGAACAAATTTGTTCGTCGCCAGTCGCTAGAGGATCGTAGGCTTAAGTTCGTTGAGCGCATTACTCCCCCTACGAGGCTGACGGTGCGCCTCGCAAC
AGGTGCATCGATGGCGGTGATGAAGTGGGATTTCACTACACGTTAGAAGATTTGCAGTACAATGATAATTTCATCGTACTTGATTTGAATGACAAATTTG
ATGTCACCTTAGGGTTACCCTGGCTCAGAAGGTACGAGCCAAGGGTCAGGTGGCAGCATCGAACCGTTAAGATGCCTGCCACTTGTTCATCAGATGGCCA
TCTGATGAACGTCTTGCTGCGTCCACAAGCGTTTGGATGTACTGCGAGTCAGTGAGATGGTCTCACTTGTGGTACGACTGTTTGTACGATTGCACAATAT
CACAGTGTGACAACCAATCACACTGTGGAGGAAGCTGCCAGCGGCTTTGTGCGTGCACAGGCGTCGCTGAAGGTCCACCACTTGAATAAGTCGAGTGCAC
CGGGACATGGATGTACGCCTAGCGGGCGACATCTAAGGAAGAAAAACCGGTTGCCCACACAGGTAAACACGATGATGCTAGGTCGACTGGAGAGTCGACC
GTAGAGGACCTGCTGTGGTAGCGCCACTACAACTAGATGACGTCGAGATGATAAGTTCCCACGTAGTCGGGGTAGAAACTCCTCAAGCAGTTATCGCTGA
GGTAACGAGACCTCAGCAACCTGAAATAATAAGTTCCCAGCTGCCTGTGGAAAAGGGTTCCCAGGAGGAAACCGAGACATGGAATGTCTTGTTAATGACG
GGTCAAGTGTAGGCGCTTATACAATTGATCTGATCGCGTCTCCAAAAATTAACCTCGGAGATAACCAGCTGCTAATGCTAGAAACGAAAAGGTTCTTGTG
AGATCTGCGTAATGGTATGGTGAAGTGCTTCCAAAATAATATTGGACTTGGCGACTATCGCAACGAGGGAAAAAGGTACCGCCTTCGGGTAAAGGGTGTC
GGAGAGATAAGGGGTCACGAAAGTGGTTAGAATCTCAGGGGGAGGGACCCGCAGAAACAATCAAGGAGAAGACCGTTGCCCGAGTACCGGTGAAGCGGTA
CTTAAAGAAGATGACTACAAATCCTCATTGGAGGACCCGGTCCCTCATTGGTTAACCCGGTCCCTCGTTGGTTGACCGGGTCCCTTATCGGTAGACAAAG
GTTCTTCGAGACTCGGCTGCTCCTGACCATTCACATAAAGAGCCAGAGCATAAGGTAGGGATAGAGTAAAGAAGTTAATGGATAGGACTATATTAAATAA
TACTATATTTGTGATCCACGTGGCACGACTTCTTCGTGCGTTATGAAACTTGTTAAGTCTACCCGCCTGTTCCGGGGCAGGGATATACTATGCCTTTCGT
TGAAGAAAGTTACGAGGTAAGATCCAGTATAGATAGAAACCCAGAAAGTATTTCGCTTGTGGGTTCGTCGATTAGCAACACCCTCCCCACGACCCTCTAT
CGGATGCGGTCTCCCCACCACGCGGTTGGGGAGCAAAGTAAGTCCAAGAAGTTAACACTCCTAAGAAAACTAGGAAAACGCCAGGAGCGAAAAGCTACCT
GAAGAACTTGATTATAAGTCCACTCTCAACTGAGTCGATCGTGGCCATCTACCGGCCCACCGAGTGAAGCATATCCACTTGAAGCCTTAGACCTACCCTC
TCAAGACCAAAACATCTTCTTCTCCGTCCGAGTCTACTGAAGAGTGCAACTCGCCAGCCTACGTGTACAAAAGATGAGTCAAGATCCATACGCGGAATCG
GGGTACCCCCCAGTAAGTCGGAAGTCCGGCACAGTAAGTCTTTAAGGGCTCAACAGACAGTTTTGAGGACCCACTCTACCACAGCGGCAAGGTAAATCAG
ATCTACTTACTCGTCGCGGAGGACGAGTGCGTGACCGAAATTTGGTCAGCAATAGTATTTGCCGAGAACGAACGGGTTTACAACAGCTCGTCGATGAATC
CTAGATGAGAAGACTTAGATGGAACGATGTACGTCCCAATCTTGGGAGTCGCTTCAGTCATATCGTTTGTATATGGACTTGATCGGATTCAAGGATGTTT
TCCCTGAATCCGTACCATACGAGTTGCCTAAGGATACAGGCAATCGATACGAAATCGAGATCAAACCGGGCTCAAATACTGTAGCATGAAGCAGTGGCCA
CTGCCTCGTGAAAAAGTACTATCTATCGAAACGTTCTTTGAAGATCGATTAGCAGCCGGCCACGTGAGGAAGTCGACATCCTCACATAGCTCTCCGACCT
TCTGTGTGCAAAAAGACACAGAAGGATGGCAGGTAGTGCATGCATTTAACAAACTGAATGCTGCAATGGTACCGGCTCAGACGCCGATACCGAGGAAAGG
TGTTATTATAGACTGTATGGCAAAGATTACCATCTTTTCGTCCATACATCTGATGGATCGTTTTAATATATCCTTATGAGTGAAGGGGACATCCCGTAAA
CAACCGTGAGCGCCCCCTGTGGTATGCCCCGGTAGTGGCTAGTAATGCCACAAGGGCTAAGTAACGCTCCCTTCCATTCAACAGATGTGTTACAGATCTG
TTGAGACCGGTGCGAGATTTCGCACCAAGTTACTTTGAAGATTTATTTATCCATATCCGGGATTTTGGGAAGAAAGACGGACGTGGAAGTCATAGAGCGC
ACACGCGCCATATTCTTACACTTATGCTTGCGCATAAGCTGTACGCCAAACCTAAAAAGTTTATATTTGCTGCGATCGAGGAACATCTTCTTAGGTGCAT
CGTGGGTAAACACAGCGTACTCCCTGATCCAGAAAAAATCAAGGCGATTACCGACTGGCATGTGTTAGTCGACGTCAAGGGACTTAAAAAGCTCCTTAGG
CTAGTGGCATACTTGCGCAAGGACTCGCGCAACTACGCCAAGATGACCGTTCATCTCTCTTGTCTCTTGAACATGAACGAGAAGTGATCATGGAACGCTA
AATGTCAGTGTTCTTTGGAGGGTTTCAAGTAAAGCTTGATGCAATCGCCCACGTTAGCAATTGCAGATCAGGACATAACATTCCATGTGGTCTGTGACGC
CAGCGATTTTGCAATCGGCTGTGCGTTAATGCAGTACTATACAGACAGCGCAGATAACCCGATGCATGACAAGGAACTCCTTGCCATAAACTA