Description :
From Genome Similarity Track
Location :
Scaffold_439:12713- 13913
Transcript NameFunction/comments
Phyke_g9497ABC transporter ABCA1 lipid exporter family

Sequence
1200 bases(100 bases per row)
ATTCTACACTCTATTGGGGTTGTACTTGGAAAAGGTTCTCGCCAAACAATACGGCACGTCGCTGAAATGGTATTTCCCGTTTTCACCGGCATACTGGCGC
GGGCGCAAGAAACCATTGCAATCAACCAGTTCGGAGACCCCCACggatgtgctgctggataaCATCACGGTGGATGTGAATTCTAACATTGAACCCGTAA
ATGCTGAGTTGCGGGAACAAGAACGACGTGGTGAGGCGCTTTCTGTACAGCGTCTGCGTAAGGTATTCGACGTTCCTGGTGGCACGAAGGTGGCAGTGCA
AGGTTTGGATTTGGTCATGTACAAGGACCAGATCACGTGTCTGCTCGGCCATAATGGTGCAGGCAAAAGCACGCTTATCTCGATGCTAACGGGTATGGCT
GCACCTTCCAGCGGTGATGCCATGTACCGCGGGCTTTCGCTGAACGAAGACATGGAGGAGATCCGTGAGTCTCTAGGcatctgcttccagcacGATGTGC
TGTTCGAAGACTTGACAGTCGAGGAGCATTTACTGTTATTCGGACGGGTCAAAGGGTACCGGGAGGACGAATTGCAGGCCCTGGTGGACTTGCAGATAGG
CCAAGTGGGGCTTACTGAGAAACGTCACGTCAAAGCGCAGGAATTGTCGGGCGGCATGAAGCGCAAGCTTTCAGTGGCAATTTGTCTGCTTGGCGACAGC
TCCCTGGTGTTTTTGGATGAACCAACCTCCGGCATGGATCCATACAGCCGTCGTAGCACGTGGGAAATCCTGCTAAACAACCGCAATGATCGTGTTATGG
TACTAACAACACATTTCATGGATGAAGCCGACATTTTGGGCGACCGCATCGCTATCATGGCGGAGGGCGAGTTGCGGTGTTGTGGATCATCGTTGTTTCT
AAAAAACCGCTACGGTGCTGGTTACAATCTGACCCTCGTGAAGGACGACGCTACGTGTGACGACAACGCTATTACTACTCTGATCTCTTCGTACGTTCCG
TCGGCACAGTTGCTGAGCAACGTCGGAAGCGAGATCGCTTACCAGCTCCCTCAGAAGAGTTCGCCGCAGTTTGCTGCCATGTTTACCAAGATTGACAACA
ACCTTCAGAAGTTGGGAGTGTTATCTTACGGGATTTCTGCCACGACTTTGGAGGAAGTGTTCATTAAGGTGGCCGAGGCGGATGATGAgaaccaccagca