Description :
From Genome Similarity Track
Location :
Scaffold_89:127123- 129727
Sequence
2604 bases(100 bases per row)
CGAGAAGCGGGGGAGCGTGGCTATGCGCGCGGCAGGTCGGAAGCGGCTGTAAGGCTAACAGTAAAAGAGGAGCCACAAAGTTTAAGAGCAGCAAACTCAA
CCCTAGCATATGAAGTCCCGCGGGCAAGCGCTGTTCGAGACGAAACTAAGGTATTGGGAAGCGAAGGAGGGACAAGGATCCCACCTGCAAAGGATGCTAA
GATCAACATGAGAGTGTTCACCGGAAAGAAACTACACAAAGGTTTGGGAGCTGGATTCAAGCATTGGGCACGGGGCGTCCGAGAAGAGATCGAAATGGCG
CAGCATGCTTGTGGATATTGACGGGCAGAAAATTCAAGATAAGCAAACTGGGAGGATGCCTTCGTGGGGAGGCAGAAAGAGTTCTTTAATGGACTTTGAG
ATGAGTGGTGGGAGATCGAGTCAACACTTAGCTACGCGCTTGAGGAGATGGAGTCAGCGTTCTCCAGAAGCTTTACAAGTGCGCAAGTGTAGGAGTTGTT
TAGGACGAAGAAGAGCAGTGGAGAGACATGGTACTCGCAATACCTGTACCTTATGGCGGTGCGAAGCGCGACAGGAGCATCGTCGTCGTTGATACCTAAA
ATCCTGGTGTTGAAAGCGAGCCCTGAGTTGAGACCTGTGTTGGCAAGCCAATATGACAAGAAGAGAACAGATTATGTGGTCCACGGGCTTGAAATAATGC
AATGGGCGCAAACGTACGAGGACAACGAACGAAGATCAGTGAAGCCGGTCAGAGTCGCCGCAGCCACCAACGGACGGTATACCGAGACGAGAACCTTCAT
GATCTGCAGCACAGTGGGCACATTGCGCATAACTGTTCAAATAAGGAATACAGAGGTGAGAACCCACGGTGGGCGCTGGCGGGGCTGGTTGCTGGAGACC
TAACAGACCAAGACTGGATACAGGAATCGGGAGCAAGCATGCACCTAGTACGAGATGGGAGCAAGCATGCACCTAGTACGATATGCGAGCATGCTATACA
AGCGGGAAGAATGCGATTAGTAAGATGGGGTAGTCCTGCCGGACAAGAGCACGCTGCGTGTGACTAGGCGAGGTTCAGAGTGAATGTTGATGACGAGACA
TATTGGGTCGAGCTGAAGAACACGTGTTATGCGCCAACGCTCTGCATTAACCTGATATTGCTGGGAACATTAATGCTACAAGGGTGTAAGCTAAGTGACA
CAAGCAAGGGATATGCCATCGTAAAAGATGGCAGTGTGGTCATGAACGTGCAGGTAACGAACAATGTTCTGGTTGTGGATCTCGTCACGCCCGGAAAGGA
AGAGAAAGGAGTGCGAGACATTGTATTGAATACAATTCAGGCGTTGGCATCACAAGAGAAAAAGGTTTTGAAGGGGAGCCTAGGGCACTTTTATCGACGC
TTTGGCCACCTCAACTACGCCGACGTTGAGAGGATGGCTGCGGATCCTAGCAATGTTATCGAGCTCACGGATAGTATCAGGGAGAACTGTTTGACTTGTG
AGGGAGGAAGACGAGCGAAGAATGCTCAGCCACGTAATGATAACGGGGGAAATGCACCGATTGATTGGTTGGCGTAATTTGCAGCGACCTGAAAGGACCA
ATTACTCCCATAAATCGCAAGAAAACCCGGTACCTGGTCAATTTTGTGGATCATAAATCCATCTACTTTCGCATATTTGTGGCTAAAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN