Description :
From Genome Similarity Track
Location :
Scaffold_465:1271- 3392
Sequence
2121 bases(100 bases per row)
TGGTCTTGGGCTGGACATTGAAGAACTTGCCCACCAGACGCTGGATCTGGTGTCCTGGGTGTTGGCTCGGGTCCCCCCGAAACTGGATGCGCCAAGGCTC
GGCTTCATCAATCTCTTGCAGGGCCTCCAGTAGGTTCGTGGGTTCTGGGCGGTGGAGGTTGGGTCCTCCAAGTTGGCTTGACGGGATACAGATCCCGGAA
ACCAAGTTACCTTATCCCCGCGTCGGAGAAGGTGCTGTGGTGTAGTAGAACACACAAATACCGTCAGATGTGGATTCCTTACACAAACCACAACGAATCG
CCGAGTTAGGTCGGCGGTTTGTATGGCCTGCGCAGAGGGTGGTCCCCTCGCGGTCCGGCCCTTCCGGGACAGACGAGTGGCTCGCTTCCACCCGGTTCCG
ACTAACCAAGTCAGATCACTTCCGAGGCTCCGCCGAGTTTGGTTCGGCTGAGCTCGTTCACAACCCTGTGCCCTCCACCAAAGGATGGACGACGGTGCGC
GAGCGCTTTTACAGGTCACCGAGCGCAGAGGCTGCTCAGCTAGAAGTGTTACGGCACCCGGGCTATCCGACGTACCGGCCCGCTGAGTGTGCGGGACTTT
CTTTCGCGCGTAGCGAGACTTTGTCCTACCCGGACCGACCTAATCTCTTGGCGCTACCAGTCAATACCCTACAAGCTATGCCTCTCGAGTATTGACGGCA
GGCATAATCCAGCCCTATGCAGGGACTTACCGGAAAAGTGTACACGTGTCTTGGACTAGGAAAATTCTGCTCTGTTATCTTCTGGGAGCCCTTTCGGCTC
CCCCTATTTAATCCAATGCTTCTTATACAAATATCTAGTGAAATGTAGTCGTTTCGGATCTCTACCGACCCTTCAGCTGAGTTCAGGCGACCGTTGAGCT
CAGCGGCTATCCGAATAGCATATCCGGACAGATCGCCGAGTACTTACCGTGATCCTTTGTTCCTAAGCTCTGGGTTATCAGACCGAGCCGATTCTTGACC
TAAAGTAGGTTGGCGTATGGTCGAATCTGGAAATCTCTACACCACAACTGCCCCGGTTATGATACGAGCCGAGCTGGTGAGTGTCTTAAACCTTCATTTG
GTTCTGCCACCGTTGGTCCGTACTCGGCTGATGACGTCTCGCGGCTCTCCACCACCTTCTTCGGTACGTTCGCTGCTTCCGCTGTCACTCACTTGGCAGC
TCCTCACTACTCGCATACTATTCCAGCACAACTCACGGCGCCACCATTCTCCTTCAACTCCTCGTCGAGGTGAAGGCGCGCCAGCTGAGTCGATTCCTCG
ACCCGTCAGCACTCGTGGGGTCAGCGACCGGCCCGAAGCTGGGTTGGTCGACTTGACAACTTCCCATGAGTCTGACGCGGAGTCGGCGGGGTCTTCTCGC
GTGCGTCCTCCTGGTCCACCGAGCTTGCCGGGCGACACCACTTCGGGCACCACCAGTCAGTCAAGCTCGGCTGCTCCAGTGAGTCTTGACTCTCTCATGG
CCAGAGTTAACGAGCAAGGGTACGAGCGCCGAGAAAAATTGACCTTCTTGGCGAGGCTCATGGCCTACGGATTTACTCGTTCCGTGGAGCCTTCCGATCC
CGCGCAGCGGCGAGCGATCTTGCATGCTGCTTCCGCGGGGAACTGTTGGATATCTTGAAAGGAAACTACGCCGCTCTTGATTATCCACAGATCATTGGCG
ATCTCTGAGCTGACAATCAAGCTGCCCAGGAGGAGAACCGCGCACTGACTCGGCGACTGGACTCGCTTGCTCTCAGCAACGTCGACTTGTCTACTCAGCT
CTCATCGGCACGACAGCAGGTGTCCCGATTGGAGGCTGCTGCCGCGCAGTCGGCTAATCTCCTTGCGTCCCTGCGAAAGGCTGTAGCTCGGAGTGAGGCA
AAACTTGCTCGGGCTATCGCAGCTGAGCAGAGCAAGGTTGACGCTGCGTTGGGTCAAGCCCAGCTCCATCATCAGCAAGTCTTGGATCGAGACGCCGAGA
TCGACGTCCTTCTCCGATCCATTTCCGAGAGGGATGCGGCGTTCGTCACCCTTCAGGGCATTGCTTCCAAGCACTTCGAGCAACTGCAGAAGTCGGTGCG
GGTTGTACAGCTCCACCGGCA