Description :
From Genome Similarity Track
Location :
Scaffold_720:1271- 2951
Sequence
1680 bases(100 bases per row)
TAAGAGACTCTACGAGTCTAGAAGTCTTCCTCTGACAAAGGAGTAAGGATAGCTCCGCTACACTTGGTAGCACTCGTAGTCTATCTACACCTGAGTCTGT
TAAAGACTGTTGCTCTGTCAGGATGGAAACAAAGATAAACCTCTCTGAGGCCCATAGATTAGCGCTGGAGAAACTCAGAGCGCTAGTCGAGAACGAACAA
GTGGATCTAATCCTCGCACAAGGTAATGACGTGATTTGTGCCCATCTTGACGCTTTTATGCAGTTTAAGTCCACTTTGATCGGACAAGTACACGACCATT
TGGCATCGGTTATGACTACTCGGTATGTTCCCGTACCTAATGAAAAGCCAAGGGCTCGGCCCTTGTCTTGACTGTAAAGACATTTGAGGGAAAAGAAGGG
GAGAATCTCCTCCTGTGGATCAGAGAGGTGGAAATGGATATGAACTCCGCTATGCTCCGGTCGGAGCAACAGCGAGCTGGGGTGGCTATCTCAAAACTGG
GTGGTAGAGCCAGATAATGGGTTCTCACTTGTAGCACGTCAATAGACGAAGCTTTCCCCACATGGGATTTGCTAAAACAACATATATCCCGGGTGTTTAC
TCCGCCTAATCAGGCATACCGGGTGCGTTCTCTTTTCCTATCTGACCGTTAGGGCAAGAAAGAACTATTGGACTATGTCCAGGAACTGAGAACTCTAATC
GCTGCCATACTGCTTGATCCCTTACCAGAAATGGTTTTGGTTACCATCTTCATGGAGGGCCTTCGAACGGGCGTGGATCGAACGGAAGTATTCCGGGTAC
ACCCTACCTCCTTTGAAGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTACGGCAGCCCGTTTTGGCACCCATGGGAACAACCCAAACTCGAC
GAACTCCTTTAGTTCATTCAATAGGCCGGAGCCTATGGACCTCAGTCTCGCCGAGACGGACGAAGAAGCAGAGCTTCTAGCTGTAGAACAGCATCGAAAC
ATTCGACGATGTTTCAAGTGCGAAAGAACAAAGCATCTACGACCAAATTGTCCTTTACGCAGGGCACGCCAGACTACTTCAGGCCGAACTCCCGCCTCTT
ACCAGAAGTCTAGTACGGTGCGGGAAAACATAGATTCCCAGTAGGCACGGGCCACCCTGCTGGGGAAAACTAGGTTCTGTTGAGCCTCTAGGAGGTAGTG
GCGAGCAGAATTTAGCCCCAAGGAGTCCCGTGTACTCTAACACGAAACGTGACTACGAGCCAGGCTTGTTGGTGACTGTTAAGGGCTTTGATCGACTCCG
GAGCATCCGGTAATTACGTCAGACGCTGTTCCCCAGAAGGGAATCCAGGTTATGTTGAGGCACTAAAAGCGCACAAGGGGGATAATATCACTGTTCGCTT
GGCGACAGGGACTCTAGTCACTGCAACGAAAGTTCTTGTGAACTTGGGTGTGAAGTTTTTCGATTTTGATAGTATCAAACGCTCCTTGATTTGGACTCGA
GATATCTCATTTTTTATGGCTTGGTTCGAGCGCCATGAGACATGGATTGACTGGAGGTCGAAAACATTAGGCGCCACGCGCACTACCTCAAGCGGAGCTT
TGGAGAGTCACGAACCCACCTCTGCTAGGAATCAGAACCGTTGTTGGCGCGAGCCACTGGCTGACAATGCCAGTGTGCTG