Description :
From Genome Similarity Track
Location :
Scaffold_3594:1271- 2554
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3594-fgenesh-gene-0.0Lysosomal alpha-mannosidase

Sequence
1283 bases(100 bases per row)
GGCCCGCCCGGCCATTTCCACTGGGACGGCGACACGAGCGTGCAGGACGACCCGTCCATGCACGACTTCAACGTGTGCGATATCGTCGAGTGGTTCGTGA
CGGACATGCAGATGCGCGGCTCGCACTCGCGTGGGAACCACATCTTCGTGCCCATGGGTGACGATTTCTCGTACCAGAACGCGCGCCACTGGTACAAGAA
CATGGACAAGCTCATCCACTATGTGAACCAAGACAACCGCATCAACGTGCTCTACTCGAACCTGTCGTACTACACGGATCTCAAGCTCGCGGAGAACATC
ACGTGGCAGCTCAAGACTGACGACTTTTTCCCGTACGCGTCGCAGGACCATGAGTACTGGTCCGGCTATTTCACGAGCCGACCGGGCTTGAAGAAGATCG
CACGCGTCGGCAACTCGTTGCTGCAGCAGCTGCGTCAGCTGGATGCCGTGTATCAGAGCCACCACTCGGCCCAGCTTGACAAGCTCCAGCGTAGCATCGG
GCTGGTGCAGCACCACGATGGCATCTCGGGCACGGAGAAGCAGGTCGTCTCGGATGACTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCTCGGTTCCGATCGATCGCAAGGCCGCCAAGGTCACGTCGCTTTCCGGCGGACCCGACCCTAACAACGNNNNNNNN
NNTTCGGTTCCGATAGATCGCAAGGCTGCCAAGGTCACTTCGCTTTCTGGCGGACCCGACCCTAACAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGGCCCCCACGGTC
GTCACTCAGGAGCCTACCTCTTCCGTCCCGACTCGAAGAAGGTATTCTCCATCGTTCGTGACACTCAGGCAACCGTCACGCTC