Description :
From Genome Similarity Track
Location :
Scaffold_422:12709- 14454
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_422-snap-gene-0.11Peptidase
Pytir_DAOMBR486fgenesh_masked-pir_contig_422-abinit-gene-0.27Conserved gene of unknown function

Sequence
1745 bases(100 bases per row)
GGGATGACAACTCGGAGAAACCGTTTGACTTCACTGCCGCCTACGGATTCGCAGACAAGGATGCTGTGGGACCGCTCTACACGGGCCGCCGCATCTGGCG
CGTGTTTGACGTACTCGCGCCGTCGCTGGAGCTCGATGCACGTCTGGGGAGCTTCTCCGAGTACGCGACGTACCCTTTTTCCGTCAAACCTGACGCGCGC
ATCGAGCTCAACACTGTCATGGAACTACTTCGCGACCACTACGAAGGCACCAAGTACGACATGACGAAGGGGATCGCCGCTGGTCCGTTTGGATCCCCCG
TGCGCTGGGGTGGCAACCCGCAGGGTGTGATTGGCGGCTGGGAGCGGCCGATTTCCATGTACCGAACGATGTTCAGCTTTGTGCTGCAAATTCGAGGTGG
TGAAGGTCGTGATCTCTCTGATGCAGTTGGAGGAGTCGCCTGGTACGCGCAGAGCGCACCACATGGCTCGGTGTACGTGCCCTTCGCGTGCACGCAGGAG
ACAGTCCCGGAGTCGTACCTGGTCGGCAAGCAGAGCGAGTTCCACCCACAGTCGGCGTGGTGGGCGTTCAACTTTGTAAACAACTGGAGTCTGCTGCGCT
TCAACACGATCAACCAGAACGTGCGCAACGAGATTGGCATTTTGCAGAGAGAGGCATTCCGAACGCGCGCACAGATGGAGCTCCACGCCACGACTGCCGA
CGGTCTGAAGAACGACTCGGCGCAGCTGAAGGAGTTCATGGAGAAGCAGAGCAACGAGTTTGCGACGCTGGTCGTGGATCGCTGGTGGCAGTTTGCGTGG
ACTTTGGTTGCGAAGTTTAGCGACGGGTACGTCACGACCGGCGAGGAGCCGCAACAGATGCAAGCCCCAGGGTACCCTGCGTGGTGGCTGGAGCTGAGCG
AGTTCTCCAAGTGGCCTGGCGATACGTTTACACCCAAGCAGTCGATGCGCGCAAAACTGACGGGCGTGGGTAGTACAATGAACACTTTTGAAAGGCCGAG
CGAGCGAGGTGACAATGGTGGTGACGGTTTATCATCAGCGTCTTCGTCGCATGGCGTCTTGGCGACCCTCGGATGGATTGCGAGCGGCTTTGTGCTCGGC
GCCAGTGTGCTGGCGTTTGCGCAGCGTCAGCGCCGAAAGCGTGATGGCTACAGCTCGCTCGCATGATTAGAAAGACAATCAAACAGACCGATTCAAGTCC
GAAGTTCCTCAGTTTTAGTCCTCAAATGATTCCTTTTTCAAGAGGACGGCAGCCAACTTTTTCACTGAACGAATGATCGATCATCAAGCGATAAACAGCT
CACACAAGTAAAGAGGAGCATAGTAAGTTAGTTCGTTAACAGAAGTTCAAATACAGCCACACAGCGGTTTGCAAACAAAGCAGCACTGGCCACAACTGCG
ACGGCGACAAGCGGTGCGCAGACGCTTTCGGCGCCACGTATTCGCGGATTGAGCAGCGCGAGAACGTAGTGTTTGGAACAGACTCCCACGGCGCCTTGAC
GCAGTCCGCTTGCTTCTTTGGGCTGCTGGTCTTGGCGGTGAGCAGCTCTTCTTCTTCACTCACACACGGGATGTTACCGCACACATTCTCCAAGTACATC
CGGTAGAAATGCGAGTAGATGCACTTGTCAGCGACCTCCACGCACAGCGATCGACAGGGCGGCAATGGAACAGGAGCGTCGTCTGTGGCTGTCGCGCAGG
ACACGTTGACGCCGTCGATCGCGCGCTGGAACGTCGCTGCCACCC