Description :
From Genome Similarity Track
Location :
Scaffold_467:12705- 14114
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_467-snap-gene-0.13Glucan 1,3-beta-glucosidase
Pytve_DAOMBR484maker-pve_contig_467-snap-gene-0.14Exo-1,3-beta-glucanase

Sequence
1409 bases(100 bases per row)
CGAGCTCGTGCTCACTGGCATGTGACAGCGTCGTAGTCGGATACTGTGTAGCAAAAGTGAAGCAATTCGCCAAAGTTGAATGCAGCAATCGCTCGTTGCT
GATGATGACAACTCTGCACAGGTTGTCTCATTCTTGTGCCAAAACAGGAACTGATTGAAGTCGATACGCTCGACTGGGTCTTGAACCACCGAGGCTTGTT
GAACGATCGCGAGTGACAACACCCCATGAAGCCAGATTTCGCACCCGGATCTTGCGATCTCAAATCAGCAGAAAGCGACCTCTCAGATGGTATCCCCATT
AGTCAACGGATCTCGACCGTTCGTTGCGCGGGACAGCAAGATCGCGATCCGTTAAGGCTCTCGTCATCGACGAATTTTTGGGTCGCCTGCTCTCTGGTGG
ATGCGGACGAGACATTTGCGCGTTGACAAAACCGTCGCCGTTGAAGTACCCTTCCGTCTTGCCACTTCCGCCTCGCCATATTCCGCCCCACCTTGCCACC
TTCCGCCTTACCGCCGCCTCTTGGATCTCCGCCTCTGCCGCTCCATTCGACGCTTCACTCGACGATCCACCATTTCTCAACACGCAGCACCGCCGGCAAT
TGACGATTCCAGCCGACGACCGACCATGCGGCTCCTTCTCTCACTGCTGACCTGCCTCTCCATCGCGACCGCGGTCGTGTCCGCGGAACCCTCCTCGACC
GACAACGTGCAAGCCGCGATCCACAGCGGTGACGCCCGCATGCGCAGCGTCAACCTCGGCGGCTGGCTCGTCAGCGAGTATTGGCTCTCGTACAGCTCCT
CGCTGTTCGCGGGTATACCAGACCGCGAGTTGGCTCGCCGCGGCGAGTATGGCATTATGAACTACCTCGGTCGCACTGCTGGGACGGCGGCGTTCGAGAA
GCATCGCCAGACGTGGATCGATGAGAGTCACATCGCGGCCATTGCAGCCGCAGGACTCAACGCCGTTCGAGTTCCGGTGGGTTATTGGATCGTGTGCGAC
GACGACTCGAGTGGCTACAGCTTCGGGCTGCGGGCTGGCTGCGCCAAGACCGAAGCTGACGCCGACGCGAGCTCGGTGCCGATCAACAAGTACGCGCGCG
GGTCGCTCAAGTACCTCGACGCGCTGGTCAACGACTGGGCTCCGCGCCACAACATCGCGGTCATGCTGAGTCTGCATGCGCATGCGGGCGGCCAGAACGC
CTACGAGCACAGCGCTCCAGAGTCGGCTGGGAAGTACAGCTGGCTCGAGTCAGACGCGAACCGCGCCAACTCGGTCACATTTGCGACTTTCCTGGCTCAA
CGGTACGCGTCGAGCCCGGCGTTCCTCGGCATGNNNNNNNNNNGTGCTCAATGAGCCGCAGTTCGGATGGGACTCGAAGCTATCGTACGACGACCAGCTC
GGTCTGCTG