Description :
From Genome Similarity Track
Location :
Scaffold_67:12704- 14596
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_67-fgenesh-gene-0.17Vesicle transport protein SFT2B
Pytve_DAOMBR484maker-pve_contig_67-snap-gene-0.30GA18394

Sequence
1892 bases(100 bases per row)
GAGAACTGGATGATCACCGACAGCAGCACGAGTCCCACGCGGTGCGGCACGTTGTGCGAGAAGCACAGCACGAGCGTGATACCCATGAAGACGAGGTACA
CGATCGCAGAATAGCGCCGCTTGGAGTGGAACATGGCCTCCAGCTGCTTGCACGGGCCAACGAAGAACATGGTACACCCGAGCGAAAGCAGGTTGCCGAT
AGTGTAGGCGATCGCGAACGGCGCCGGGTTGCCGTGCACGAGCCGCGCGAGGCGGAACGTCGAGCCGAGCGAGAGCAGGAAGCCAAGCACGAAGCACGTG
ATGAAGCCGATCGTGCGCTCCTGGTACGTCAGACTCGGACAGAGCGAGTTGATGCTTGCGCGCAGGTTGTTGGCCTCCGTGTTGTTCGGCTGTCCGCCCA
GCTCGGGGTCCAGCAGCTTCTGCTTCTGCTGCCACAGCTTGTCCATCATGACGCCTTCAACAAACGGGAGGTCAAGAGAGGAAGCGAGCGAGGCAGGCGA
TGTCGCGGCCGATGGGACTGGCAGCAGGTGCCAAAGCGCAGTGTGGGATGGCTCGTGTCTGCTCGGCGGAGGGGCTGCGTTCTCCTAGACGGACGGAGGG
TCGTTCGCTGCCTCTCGGTCGGCCGAAGATTTTGGTCGTTCGACTCAGGTCGAAGGATCAAAGTTCCTCATCCATTGGTGGCACGAAATGTGGATATGTT
TCGTGTGGTAACATAATTGGTAAGCGGGGGCACTAGCCAATTCAAAATGAGGTTCGCACGCGAACTTAACGACATAGCCAATCGCGGTGACAGCAAATAA
GGCAAGACGGACGGACGCGATGGCGGCGCTGCAGGAGGCCAAGTTCGCGTGCTTTGACGACGGGGAGCTCGCAGGGGCCGAGGTCTCGCTGACGGGGTCT
GGCTCGGAGAGCTCCAGTCTCCCGGTCTTCGCTATTGCCTTCCCGCCAGGCGTGCGCAGTCAGTCGCCCAAGAGCTTCGCGCGCGGTACGAATCCGATCG
CTAGAACTGGTATAACCTCCCTTTTCGGCTAACGATCGTTGTTCATAGCGCGGTCGCTCGAGTGTACAGGCTCCGGGAGCTTCTACTTCCAGAACGAGGC
GCTCAAGGACCGCTTCGTGTGGTGCGTTTGCTGCTAAAAGGCGATCTGGACGGCTCGTACACAGTTGCTGACACTGTTTTTGAAGCTGGCGGGTCATCAA
CAACGTCGTGGTGCTGCGCGAGTGGAGCCTGCACGTCTCACTGGCTCACAACGGCGTGCGTTTCGAGTTTCCGGGTGGGTCTTAGCCTCAAGTTCATTTC
AAAATGCCAAAATCCTGACCGACCTCATGTTATTCATGTGCAGCTCCGGTCGTGGCCACTGGTGTGTACGCCGTCGAGTCGTGGGAAGACAACAGCGTCA
CGGTCAGCATCGTGACCCACGCCGGGACGATCCACCGCTTTGCCTACCCTGTCCCAAGCGATGTGAATCAAAGTATCTTTTCGCATGCTGACCCGAATGC
CTTCCCGGCCAAGCCCACGACGAGTGTCAAGTGCGACGTGATCGGAAGTCTGGCGGCCGATGAGATCATCTCGGTCGCGCTCTGGGTCAACGAGTTCAAC
TTGACGCTCGGCACGGACTCGGGTCGCGTGGTCGGTGTCAACTTCGGACTCCCGACAGCGACTTCTTCTGGCGGCGAGGTGCAGGAGTTCGCGTTCTCGG
ACGAGTCGATGGTCAAGTGGCTCTGGCAAGGGTTTCTCAGAGCTCGCCATAGCGATGATGGTCGCCGTGCTGGCAGTTCATCCATCATAGCGATGACGTG
CTTCCCGATGGAGAGCGAGGATGAGAGCGAGGAGAATGACGTGTGTCTGGTGACCATCTCGGCGGACTGCGAGCTGCGTGCGTGGTCTTACA