Description :
From Genome Similarity Track
Location :
Scaffold_1069:12704- 14326
Transcript NameFunction/comments
Phypl_g12254hypothetical protein

Sequence
1622 bases(100 bases per row)
ATGGTATATGGTACCTTTGATTTGGTACACTGCGCGCCAGGTTATTATGACCACCCACGTTTTGTGGCGCCACTCGCTCAATTTTGCGAGTTGAGCAGca
ctgtttagatatgttgccGCTGTCGTATAAATGCGATTGGGACATGTTTTAACGTGTACGATATCGCAGTTTAGAGGTAGGCTACTATACAAGCGACCGT
TTTGGTCAGTGCGGTGGCGCCCATTATTATGACCACACACGacccatacaaaaaccaaaTCAAAACGAATGATGATGAGACAATGGCTACATTCGTAGTG
TGTCTTGTTACcgtgcttcttgatgacTTCCTTACACCTGCGAGGCATCGACTCGATCAGCGAGGTCATGATCGATGTTTCGATTGACTCCCATGCGTCC
AGCACAGCTGCAGTTAGTTCAGCGACACTACTGTACTGCTTGCCATTGGCGTACACACGCCGACTCATGATCGACCACAAGTTTTCGATCGGATTTAAAT
CCGGTGATCTAGCTGGCCAATCCAGCACATGCATGTATTGTTCTTGAAAGAACTCCTTAGTCCTGTTCGACCGGTGGATGGATGCACCATCTTACTGGTA
CACGAAATCGGTGCCATAGTGCAGGTGCACAAACGGCAGCAGATACTCAGACACGGTGTACACATAATCGTCCGAGTTCTTCTTGCCATGCAGCACCGCA
AGCTTCATCTTGCCTGTGATGCTGAAGCCCGCCCACACCACAACCGATCCGCCCCCAGCCTGACGGGGCTTTGTCTgccgaggtggccgacgGATGTCCC
TCCAGTTGGTCTGGAAGCCGTCGGGCCCATCGAGATTCTACTTCTTTTCGTCTGAGAATATGATGCAATCCCAGGACCCGGCGGCATCCGTGTTCATGAT
CCTTGCCCATGCCCACTCCTCTCTCGCTTTTTTGTCCTCCGCTGACAGCGGCAAGGTGTTGTCCATCTTTGTGAAAATCAGCCAGTCGACACCGgcaagg
acgcgctggatAGTCCGCACCGATGCCGACAGGCTCAGCTCACTCTTGAGCTGCCGGGCGGAGAAGTCGCCCTTGGCCGCTGTGCGCAACAGCAAGCGCG
CCTCCCTCTCAAACATGGAAGCAGCTGGCCCCGGCCTCTTGCGCTCTTTTTTCTTGCCAAATAAGACGCGGTGAATTGCTCCGCGTGAGCGCTTGACACG
ACGCTCTATCTCTCGCAGGCAGAAGCCTCCTTCATGCAGCCCCTTGATTCGTCCCTTCTCCTCGTCAGATAGCGGTGACCCCCTCCCCATAGCTTTGGAA
ATGACAGCTCACAGCGAACGCAGCAAGACCAACACTAGCGTTGGTATCGATTGAGTGGCAGCCATCGTCTCATCATCATTCGTTTTGAtttggtttttgt
atgggtCGTGTGTGGTCATAATAATGGGCGCCACCGCACTGACCAAAACGGTCGCTTGTATAGTAGCCTACCTCTAAACTGCGATATCGTACACGTTAAA
ACATGTCCCAATCGCATTTATACGACAGCggcaacatatctaaacagtgCTGCTCAACTCGCAAAATTGAGCGAGTGGCGCCACAAAACGTGGGTGGTCA
TAATAACCTGGCGCGCAGTGTA