Description :
From Genome Similarity Track
Location :
Scaffold_335:12703- 18122
Transcript NameFunction/comments
g18037.t1hypothetical protein

Sequence
5419 bases(100 bases per row)
CTCACTTTCCGGTGATCATGTGGATTCCTCACGGAGTATTACCACGGGACGAAGGGTATGTGCGAGTGAACTCAGCGAAATATCGTGATTGGCAAATACT
TGCCTACGAAGGCGCTCTCGACAACAGGCTTCTCAAGCGAGAGCAGCGCTTGTATATGGAATGGCTGAGTCGACAGCCTCCCACAGTCGAGCAGCATCAT
TACAAAACTCCCAAGGCGATTCAGAAGCGATCGAGTCGTAGCGAGTGTACAGATGAAGCAAAGGTACAAGCATCGGAAGAGCTCAGCGAGGACCCAGACT
TTCAAGGGAGTTCCGCGCTTGCTAACTGCGAAAAAGAAAATGACGACTCAGCGAATCTACTGAAGATGGACTTAGCGAGAGTTTACGACGATTCGCCCCT
CAGTGAACCCGGAACAGACTCAGCGAGTCAGACTCCGGGACTCAAACCGGTCAATTATGAACGAAATTCGCTGAGTCTTACTGATGAGCCACCACCGACG
CTAACAGTAGCTGCATCCGATGGAAATATTGATGGAGAGCACTTGATAGGTCACAAACACCCCATGGTTCGTTCACCTCCAAGCAACGGTAAACAAAAAA
GGTGTTCCAGCGAGATGGACAGAGGTGACCAATGGGACCCGGGTGAAGCTGACTCAACAGTTTCGACGAGTGATCGTCGGACGACGCTGTCCGAAGCTAA
CCCGGCGAGTGAATGGTTGGATCCCGAGTTATTGCACACCCGAGTGCCACGTGATTTTGAGGGGCACGTCCTGTCTTTCGACGGGTCAGCGAAACCGGAG
AAGTACGGCGGCTATGGGAGTTGCTCGTGGATTTTGTGGCGTTTACCAAATTGGGACATTGTGATCGCTGCGAGTGCTTACCTGCCGTCAACCACGGCCA
ACATCGCTGAGTACATCGGGATGAACCACGGTGTTCTTGCGGCTGTTGATCGAGGAGTGACCGATCTGATCATTGTGGGCGACTCCAGGCTCGCAATCCA
GCAATCCATGGGGGTGATGGCATGCAAGAAGGAGACCCTGCAAATTGAATTAGCACGCCACAAAAAACTCGTCGAACGCCTAAGTTCGGTCCGCTACTTA
CATGTAGTCCGCCGTTATAATTTGGCGGCAGATGCATTAGCCACTGAGGCTCTCGAAGTCATGGCAGGACGTGTTATCCTCAGTGGAGATCGAAAAACAG
AGCTGCGAACATTAAACCGAATCCAAGAGAAGCTGTATGTAGTCAAAGACTCAACGAACGAACGAAAAGAAGTTCCAAAAGTCTCAGCGATCACGCGAAG
CCAAGCTGATCACGTTCGCCGAGTCAGATTCGCCGAGGAAGAGCTAGATGACGCGGCGCATAAACCGGTAGTGCCAGATGCACGATACAATGACGTCTCG
CCGAATTTTCGCGATGCTGGTAGTCCCGATGATGTCTTGGAAGTGGTGAACAAGTCTCCAAAACCTCAGCGAGTTGCCGAGCGAGGTCACCCTGAACACA
AACGACTAGAATCACGAAGTGAACACGATATCGACCCAGTAGTCGTTCAGACAGAACAACGTGAACGAGTATCAGCGACACAGGACGAGAAATGGAAGTG
GCCAGATCTTTAGAAGTTCTTGCAAGACGAATTGGACGAGTACCGACCGAGCTCAACGTCGGTTTTTAGCAAATGGGTCGGTTACGATGAACCCAGCTGG
AAACCGTTGTCGAATCTATAGTGGGGAAGCCTTCTCTTTGGCTACCTCTGCCAAATAAAACGTGAAAGCCGTCTGCAAATGGTGCAAGTTGCAGACGAGA
GTTAAAAGCTATTGCATACGAAGATGACCACCGACCTGTGAAGACAGCAGGCAGGACGAGTGGATGAAAGCTACTGCGTCAATTATATGAATTGGTATTA
CGAAATGGATAAGGTGTGGATTACGAAAGAACAAGAGAGAAAGAAAAAAACAAGACTCGTCGAAATCAGCAACTGGACGAGTCTATATCTTGGTGACCCG
GGGAAAGCTACTCGGTGAAAATCTGCCTGCTGAATCTCGGCTAGCCAGGCTAAGACTCGTCACAAATGTCCTCGAACATGGGGTGAACTTGACGGATAAA
CACTCGAAGCGGCCGGGTATGATTTGCTGAGCGAACCTTGCTAGGACCAGTCGAACCGAAGAATGCATAGCGGTCATCGATGAATTGCTGGCAGGGGCAG
TCAAACTAACCTTCGGCTTGGCCCAGGTTTCGACGAGCTCCTGGCCTTCTTGGTAACTCGGCGAGAAAACTTCGACGCTGCACGTTTCTTAGATGGCTTG
TCGGAAGCAGCTGGAGCCCTTCCACATGTCACAGCAAACGGAGCAACAAAACGAGCTTGCACCGGTGTCGAAACAGTTGGAGTAGGCGAATAAGCTAATA
TCTCCGAGCTGTTTGGCTTGGTTCTCGAGGAAACACTTGCCGAAAGCGACAAAAACTGAGCCGATACCGCCTAAGCGCCACTCGATGCGTTCCGAGGCAG
CGCAGATAAAGCTGTCTAGGTCGACGAGTTTGGATGATGTGCAGATGTAGACGCAACACTCGACGAAGGACTGGAGCTATCGAAATGAGTCACTTGAGCG
CGTGATAAGCCCACCAGTATAACCGACGAGATGTCCGTGCTTGAATTGGTCGTACTCAGCGAGACCAGCGAGCGATTGCCGGATTCGCCGAGTTCTGACG
TAGCAACGTGTAAGAGAAGCCGAGGACTCGTCAAATACCGCTGTGATATGAAAAGGCGTCGCTAGGCTGAGGACTTCCTTGCTTGGGATCAGACGTTCGA
GTGCTTGGAGCGAGGCTGCCTCGGAGTAGTAGCGGAAGCTGTCGAAGAGAACATGGAAGCGAGAATCGCCGAGTTAACCGGAGCCTTGTTCGCCGAGCCG
GCGGAAGTACGAACCGACGTGTTGACGGGACGAATGTGGGGAGTAATTTCGCTGGACTCGTCAAGCTAGCGAGTTCCGTCCGAAGCCCAGCGAGTCCGGA
CTTGGCGATTTTCGTCCCAGTCTCAGCTATTGGTCGCACCAGGAAGCCGTGTGGCCGTGTTGCGCCTTGCCTCAGTGCCGTCGGGGTGTCAGCCAGTGTA
TTGGCACTCAGGATGGACTGACGCGACGAAACTTCGTCCAGAGGCGTCGAACCCGTCACATAGAGAGAGAGAAGCCAAGCCAAAGACGCGTCCTGCTGTT
CCTGGCTCTCCTCTTGACTAAAGAGAAAACGTTGAATCTCAGCGAGGCCAGCGGAATTGCTTGCCGCGAGATCCGACGAGTTATCGGAAATTCGACGAGT
CGGGCCGGACCGGACCGAGAAGCTCAGCGAGTGGGAGCGAGCAGAGGCTCCAGCTCTACCAGGTGTCGACGAGTCCTCCGATGGTGCAATAGGAGTCGAC
GAGAGAGCCGCAGCCGAAGGCCCATCTTGACTCAGCGATTTCTCCATGTTTACGACTCCAAACAGACTTGTCGTACGTTTGCGGGGGAGCAACACTGGTC
TGTCCAGCTCAGCGACGAACTTGTCGACGTCCGGGGAGGGATCACGCTGTCCGACATTGCGGAAACGAGATCCAGAAGAGGTGAAGAGTCTTTGCACGGT
CGGACACGTCAGCAGAAATGGCGGCAGGTGCGGGGGTCCATAGAAAGGCAACCAGACGCACAAGGGTGAATGACTAGCAGTCCACCGGGAAGAACAAGCG
ATATACGGAGCAGCAAGACGTACCTGGTCATCAGAGGAAGACGACAAGGCGCTTGATGTGCGCACCAAGCAAGACGGAGAGAGTTTCTCACCGTTGGACG
GTTGGAGAACAAAGTGACGAAGTGAGTTTCTGACCGTTGGACAGTTGACAGCTGAATGATGGTCGAGACACTTACCAGCCTGGCTCGTATCACGCCCGGG
GCAGTTGTGGTGTAGGGAAACTCATATTTTGGGTAGACCACCCATTCTGGCCCAGCTAAGTACGTCGTACCTAATCGGAGTTCGCACCTAAGCGGCGAAC
TCGGCGAATCGGTCGGACTCGGCGAGCACCAAGACTCAGCGACTCAGCGAGCGTATTCCATTTGGGAGAGGATAAATCAGGAATCGGAGCGAAGGGTCGG
CCGAGATCCATAACGACCCGACTCGGCGAAGATCAACGAGGAAGCTGAGCGAAGAGTCGCAGGGAGATCTATAACGACTCCATTTCACTAGATATTTGTA
TAGGATCGATAGGAGACCAAAGGGGGGAGCCCGAAGGGACTCCCCGAAGACACAGAGATAACAAAACAGAGCAGAATCTTCTAAGTCCAAGAACAGCGTA
TACTTTCCGGTAAGTCCCTGCGTGGGCTGGATTATGTCTGCCGTCGTTCCCCGAGAGGCATAGCTTGTAGGGGAATCGACTGGTAGCGCCAAGAGATCAA
GGTCGGCCCGGGGTGGGCACTTCTCGCTACCAGCGAAGACAAACCTCGTCGAATCGACGAGTCGGTGGGTCTGCACAACCCAGGACACCGCAATCTTCTA
GCTGAGCGTACTCTGCGCTCGGTGACCTGTAAAAGCGCTAGCGCGCCGACGTCCATCCTTTGGTGGAGGTCACAGGGTTTGAGGAACGGAAGCTGCCCCG
CTCAGGCGAGCTTCTGGAGTTTGGATTGGTACTCAGCGAGAGTAGGGCCTCAACTGGACCCGGCTGGGCCGAACCGCAAAGGGAACCAACAGAACCCTGC
GCAAGCCCAACAACGCCGACCTGACTCGGCGAATTGTTGTGTTGTTGCGTGGAAGCCGCACTAACGAAGTTTTTGTGAATCACAACACCACATCTGTTGA
GCCTCAGCAAGGAGGTCAGCAGGGCTTAGCCCCGAAGAGCACCGTGCTCTTTAACACGGAACGTGTATGCAAGCCGGGCTTGCTGGTCGTTGAAGCGACC
GTGAAGGGCTTTGATAAGCCGTGGACGATATTGATCGATTCGGGAGCGTCGGGCAATTATGCTCGACGCTCCACGATGGAAGGAAGTCGGCAGTATGCCG
AGGCGCTGGTAGCGCGTACGAGTGATATTATCACTGTCCGTCTCGCGACGGGAACCCGCGTTACGGTGCCCAAGGTTCCTGTGAACCTTGGCGTGAAGTT
TCTGGACTTCGATAGCGTTGAACGCTGTCTGGTCCTTGACCTGGATTCGAGATATGATCTCATCCCGGGCATGGCATGGCTGGAACGCCATGAGCCATGG
ATTGATTGGAGGTCTAAGACCTTAGGCGCTACGCGGTTGCCTCCTGGTGAAGCTTTGGCGAGTCATGAACCCACCTCTGCTAGGAAGCAAAAGCGCTATT
GGCGCGAGCACTGGACCGAGACGGTCAACGTGCTGGACATCGGCGTGTCGGAGTTGGTTGACACTCATGATGTCGTAGACAAGAGTCCCGAAGGGGCTGT
ACGTGGAGCGGCACGTAAT