Description :
From Genome Similarity Track
Location :
Scaffold_1:1270204- 1272955
Transcript NameFunction/comments
g400.t1ETK90256.1 hypothetical protein L915_05946 [Phytophthora parasitica
g401.t1RAW43374.1 hypothetical protein PC110_g516 [Phytophthora cactorum

Sequence
2751 bases(100 bases per row)
TTGTGGTTTGCTTCCTCCATGGTACTGACGATCGCAATCCAACGGAAGATGCAGAAGAAGGCCCCACCTCAATTATCAACCTATGCCACAAACACGACGA
AGAAACAGAGGCTGCGGAAAAGAATCAGGAAGGAACTAAGCGCACGAAGAAGCGTCGGCTCTGTGCCGTGATGTCCCAGTCAAATTCAAGAATCCGCAAG
GGGCTTCACCATCTCAACGTGGAATATACCATGCCGTACATCAACACCAACCAGACACAGCGCGAAGTCGGCGCGTTTCACCTGCTGGAGGAGGAGCTTG
AGGCAACGCGGTCGGGAAACAAGGATAAACGCAGCGGTGGCCTTATCGCACCCGTGGCTCGTACAGTATCCACTCCAGAAAATATGCATGGCACTGACTC
ACTCCTGCTCTTCCACGGCCATGACGCTGTACATGGGCTCTATGAGTTCCTCATCAACCGAGCGCGTAAGTGACGTTCTGAATTGTGTTGCTATCGGTCT
CACTAACCTTATACTTGTCGCTGTCGCTGCAGCCATGTCGAACCAGGATGTCCCGGAGCTGTACACGTTGCACCCGTTCACGAACGCTTCGATCCAGAGT
TTGCAAGTCACTTCATTCGGCCGAGTCGGTGGATCTGCGGCTGACCCGCCTTCAGAAGACCAGCCTTCGAGAGCAGCGACGCTCTTTCGGACGGAGATTT
TGGGATTCTGCTTCCCTTCGAGCGTCGCGAAGCTGCAGGGCGTGTTGAAGGATGAGTGGGAAGCAACAAAAGCTTCCTACGGCTCTGCTGCTGAAGTCTC
CCAGACTGGAAAACACGATGCCCAAATCGCACTTCGCACGTACATGGAAGCAGTGGCAGGTGCCGAGCGGTTGAACGCTGTCAAGTTGGGCGCGCAGACT
ACCGGCCCCGGAGAGAAGCGCGGCGACCTGCGGAAGCGTCAGCAGGAGCTCGAGTTTTCCAAGAGACGCGTGGAGGCTGTGATGGTGACGAAGATGGAGA
GCCGCTACGACGTGGAGACTACAACGCGGACGATTGTGGCTCGGCGCTGAGCGCGCGCTGCAATCTTTTGCCGTTCGTTTGGCTAGCGGCTGGAATGGAG
GAAGATCTCGAATGAGCGAGTGGCGCAGCCCACCGAAATCAAGCGGGCAGCTACTGGGCGTAGGTAACCTGGCAACGATGTGGCCAAGATCGACAATGGA
GAAACAATCGAACGCTTGGCATCGCCGTTTGCTCGTGCGTTCACAAGGAAGAGCCCACAGGTCATCCGATGCACGCGCACTGGTCGCGTGCGACTGCGTC
CGCGAGCGCAGATGCAGCAGGCGGCAGCTCTCCGGCCAAAGTCGTCACGCATAACGAGTAAATATTCCAGCACCAGCACTCAGTCTAGAGTCGCGAATAA
GGCCGAACACGATGGCACTGCATGGCTCTCATCAAAAGTGTCCGTGAGCTAACGTTGGTGCCGTCAACACCGTGGCACCAACCAGTTATAACCTGTTTTC
ACAGTCGGCGTCGGAGCACCGTGCTCCGACTCGACGGCCACCTCGATGGCGCGAGAATTTCTCCCGAGGAGAGTTCTCCGGTCACGCTTGTCCATGATTT
CCCGGGGCGAAGGGCAGCGCTCAAGAATCGCGTGGGGCAGCCACCCGCCAAGCTCTTCTTTGTCTCGATCATCAGCGTTGGTGACCAACTTGGTCCGCTC
TGGCTCGGCCGCGGGCCACGAGCGCTGCCCATCGAACGCGCCGTGCGGATGGCTGCTTGGCGAGTGCCAGGACGGACCACGTCACTTCTGAAAGGCCTGC
AGCTCGCTTTTGCTTAGCAACCCGCTCTTCAACTGAGAATCTCCGCGCTCTGCCGTCGGAAACGATGGTCCCGTGCGCCGCGAAGCCAGCGCACAGGCTC
AATTGCTGAGCTGAGACCTCGCGCGGCCCATCGATGGCCGTTCCCTGGCTGGCTTCCTTCCTTCGAAAGGCGAAGGCGATTGCTCGAGGAGAATGCTCGA
GGCGATTGCTGCCAGCTGTGTGCGCTTCCCAACTGAGCCCATCGAGCGCGGCAAGTGTCAGCAGGCATTAATCCAAGCTGCAGACTTGCCTTTTGTATGG
GCACGTCGATCCACTTCAAGCTGTTAGCCAAATCTCGCGAGTGAGTGCGGGAAGCACGTGCGACTCGGTGACGAGCTTCGGAGAGGAAGAGAGCTCGCCA
AGACCAGCGGCGACCAGTGCGGATATCCTCATAGCACCAGCAACTAACGCCCTCTCTCCGGGCTGTTCTTCTGTTATCTGCAGCTGCAGTGCTGGTGGGT
GGTAACTTGCCAAAGTCAAGGGCTACACGACTCCCACACAACTCGGTGACCGATACGGTCCGGCTATGTTTCCGTGGAGATGGGCACGGTTCGTCGATCG
CCTTTGCCGTCTCTATGGCTGGCTCCTCTCAGTCGGCGATTTCCCCCGCGAGAGGCACAGTCGGAAGCAGGTCGAGGACGTATCCGAGGCTTACCACACC
GCGGGACCTCTCCCTCGCCCCTCCATCGGCCTGACCGCCGAGACGCCATTGTCGCTTTTGAACGAGCAGCGTCCGCCTCGGCCCATGGGCCTCATCGCCT
GGTTCAGCCTCTTCAAGTTCAGCTGGCTGCGCAGATGTAAGACGTGCGGCGTGCGCGGCTCCAAGTGCCTGTGCCGGCGGCCGTCGCTCGCGCTCGAGCA
CATTTTCTTCCTCGAGGAGCGCAAGAACAAATTCGGTGCGCGCAACTTCAG