Description :
From Genome Similarity Track
Location :
Scaffold_682:127- 3981
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_682-snap-gene-0.6F-box/WD repeat-containing protein 1A
Pytap_DAOMBR444maker-pag1_scaffold_682-fgenesh-gene-0.3Conserved gene of unknown function

Sequence
3854 bases(100 bases per row)
AGATGAAGCAGCTGCATGCTTTTCTCTTGCGGATGTTTGCTTCGCAACCGGATCGATTCACCAAAGTATCGAGTTCTATGAGCGGAGTCTTTTATGCTTT
GAGGCTGCGGGCGACCATAAAGGCCAGCTTGAATGTTATCGCGGCCTAGAGCGTGCCTTTACAAAGGTAGAAGACAGGGAAGCAGCAGCACACAATAAAG
CGTTTGCAGATGAGTTGGAATATGGTCTTGAGAACAAGCTACGAGCAGCCAATAGTAAACTGAATGCACTCCAGCAGCAGCTGGTAGGTATCGGCGCAGA
ATCAACCCTTGAAATTGTTCTTGAGCGAGTTAAGGCGGCAGTGCCTCGATTGAGACGAGAACGGATAATGTGTCTGTACAGGATGAGAGAGGAAACCAAA
TGGGTTGCTAGTCTTCAAAAGCTGTTGGAGGATAAGAAATCTCTTCTCTCGCAAGGTGAGTTAGATTTGAAGCGCGCTCTGGCAAGCGATTCGACGCAAG
TTGATTCAAGTATTATTACTGGCACTGATGCCAGGTATGAGATCGATGACTTCAAGCGAAAGCTGGCGAAGTTGATGGGCGGTGTGAAGGCTGCAGAGGA
TCACATCAGTAAGGAAATCCTAAACTCTGAAGTTCGTTCTCGAAATGCAGAAGATGAAAGAAAAGAACTTGAGGCTGAATTACTTGTAGAAACTGGAGCG
TTGATGCGCCGGATGCTGTCAAACGAACCAATACGTTGTTTTGCCTTCAATTCAACAAACGAATCACTCAAGAATGTTATTGGAACCGCAAGTCATGGAA
TCAGCACATGTTGCGCGAGTGCTGGTCTGAACAGCTTATTATTCGACATTCTGACTGGCGCTTGTTTGAGTCAGGCGGTCGGAGATCCCCATAAGGAACA
TCTCGGCGATCCAGTCGGTCATCGGGCACCGATTATTAGTATTTTTtACGTCGGAGATCGTGTTTATACAGGATCGATGGATGCGATGCTGGGCGTCTGG
AACGTCAAGGACGAAAGTATCGGTGGTTATGCGTGCAAGCTCACCAAACTGCTTGTCGACTTTGACTCGGCGGTTGTGAGTATCtaTGCCGATTCTCAAT
GGCTTGCTTGTGGCTGTTCCGACTGCGACGTTTTCCtATTTGACTCGACTTCGTtAACCCTTATGGTCCGAGTGATCGCACcTCATgaTCGCAGCACCAC
CGCAATATTtGTTCAGAGTTTCAAGAATACGTTTACCACAGGAGGCGCAGACGGTCACATTAGAGTATGGGAGGTTCAGCCTGCTTCCTCCATGGCAGCA
TCTGCAAAGAGAAAGTCgAAAaCTTCTTCATACTCTACAGCCAGAACGTCGTAGAGATGAATTTTTCGATGGCCACCTTCATCCTGTGTCGTGTGTGCGA
CAAGTTGCAAGTGAGATCGTGAGCAGTGACACTGGTGGTCGAATTATTATTTGGAACCTGGAGGCCATCGGACGAAAGATGCTTCGtATTTGCGATGTTC
ATAAGAGCGCTGTCGTGTGTCTACAATTCGATGCGACGAAGATTGTCAGCGGTGGAAGTGAcGGTATTATCTGTGTTACAGACTTTGCAACAGGCCACCT
CATTCAAACACTAGTTGGTCATGAAGCTGGAATCCTTGATCTACAGTTCGATCGTAAACGATTGGTTAGCgTGTCTGCCGATGGAAGACTGAGGTTGTGG
TATTGGCAAACTCGCATCGGAGTAGGAGCAGATCGAAAGAaGTACCACATCCTCGGTGCTGGCGAGACTCTAAAAGCGCTATCATTGAAGTACAGAACAA
GCAtcGACAAACTGCTTCAGTGGAATAACATATCTGACTCAAGTAAGCTGTATTTGGGCCAGAGGCTGGTTGTCGAGAtcGACACCGACGGAGCTGCTTC
TGATGAGCTGCAAACACTTGACgCACgCGTTTCAACACAATTTGGCAAACTTGCATATGAAGAATTGGACTTTTTGTCAGCAAACAAaGCGAAGAGCGAA
GACGTTGAAGCGCAATGGGCAGCTCAGCGGCTGGCACAGCTCGCAAAGGaGTACTTCCCATCTCTGACGGAGGAGGACGAAGAGCACGATCATTGCAGCA
GTGAGGAGGAAGAAGAAGACTCGGATGtGGACTCTTTGATGGCCGTGGATGTTGATAAGGCCAGGGACAGCGAAgtttCCTAACATGAAgagcacgcaga
GgACCatGAGGACTAGAAGGTATGCGCATCCTGCCGTTATTCAAACTAGCCCTCAACTATACAACTGTTTTCTCTACGCCGTCATCGGTTGCAACCATTG
CAGCGTCTTCTTCATCTGCTGGGGCACCTTCTACCGCCGGAGTTTCCACTGAAACTGGTGCTGTCGTCGTCTGTTCAACATTCATAGCAACAGGATTGTG
TGCTGCGACGGCTGCTGCTTCGACTGCAGCGTCTACGCCATTGTCGATCGCCCATGCAGCCTTTTCTTCgAGATACATGTTGCAACTACGGAATGCAGCA
CGCGCGTGGTCGCCGGCAAAAAaCTCCCAGGCTGTGTAGAACCAGAAAGCGATGCACTTGCGATAGTCATTTGGCTGACTAGATTTTTTCAGGTTGAGAA
TACGACGCCACTCTTCAGTCACGAACGTCATGAGGACGTCCTGGAAGTTGGATTGATGCAATGGgTTCCGGACGGTGTAGAAGGTCGTCCAGTACTTATC
ATAGCCGTCgaGTTGCTTCAAACCCTCCGTAAACTCTGGTGCACGGAACTCTTCGACAGCAGCGTTGAGCAAGAACACAAATTTGTCGCTGTACTTCGCC
TCTTCGTCGTAAAACTTCTTCCAGGTCACCGAGAAGAACTGAAGAGCCTCTTGAGGGTCATGCTTCTTCGTGCGATGCATGCTGTGCGCATGACGAAGCT
TTACTGGCTTCTTGCGTTCCCAGTGCCATGGCTCGACTGGCGGGAAGACCGACATGGGCACCATCACCGACCCGTTGCCACAGATTGCAACGTACATGGT
GATATAGTTGTCGATCTCACTCTCCTTGTTGGCAGTAGGGCCTGATCCGTCCTTAGCAGAAGATGGCTGACCgTCAACCGATACACATCCCTCGGgCGTG
ACTGTCGAGGCAGCCGGCTCCTCATTTTCGTGGCCGTGCGGGTCTGGGCGGTAGAAATCAAGTTTGGTGACATAGTACATGTACTTGGTCGGGAACGGCT
TGTGCTCAAAGAAGTCTCGCAACTGATCCCGCAGCGTCGCcATGTCTTTCAAGTACACTTCCTTGATTtCGTTTGATGGGTAATAGTCACCTACAGGGAG
AGAGCTCCGGCGATGAGACTGACAGCGTTCCCGCGAATCTACGAGTCAGCTCGTCACTCACCGCAATTGGCACAGTCCAGTGGGTACGTTGCTGTCGGAT
CCACGGTtGTCGGGAAGCCGAAGATGTCTACTCATGCAGAGGAATCGGTCAGCATCATCAGCGTCCTCATCCtCATCTCCTGTGGCGTGACGTACTGATG
CCTTCGCGCATGACGTCCTTGTGCGTCATGTGCAGCGCGTCTTTGAGGTCATCGTACTCCGTGTTGGTGGAGCAGTACTTGTTGTAGCCGACCcAGTACT
GCGCGTACGTCTCATTAAAGACCAAGTGGCCGCGCTGCACCGTGCTGGCGGCCACGAGCCGCGAaGGGTCTGTGGCGCGCAGGCGGTCGATGTTCTTCTT
CCAGTCGCGGATCTGGCCcGTCTTGACGCCGTACTTCTGCGCCGTGGCTGCGATCATGCCCGTGCGGTCGGCCTCTTCGATGATCTCGAGCTTCTTGCCC
AcaGTGAGCTGTCGGTCCGCCTTGCCGCGCGCCATGATGCCCGCTTCAAGTTGC