Description :
From Genome Similarity Track
Location :
Scaffold_484:12698- 16488
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_484-fgenesh-gene-0.2Formin-homology 2 domain-containing protein

Sequence
3790 bases(100 bases per row)
TCGCCGGCCAAGCAGCCGCCGGCCTCGACGCCCTCGTCATCGCGCGCGACGCTGAGCAGCCGCCTGAGCCTCGCGCCGGACGACATGTTCGGCCGCGAGC
CCGCGTGCGGCGTGTGCACCAAGTCGTTCAACATTCTTCGGCGTCGGCACCACTGCCGCGGGTGCCACATCGCCGTGTGCAAGGACTGCGGTCGGAAGGC
CGTGGACCGCAACCGTACCGAGCGCACGCGGCCGCAGTGGTACTGCATGGGGTGTCTGGACGCCGACCCGGCGCTCGAGATCACGGGCACGCGCTCCACG
TACAGCAAGCGCCGCAGCTTCTCGGCATCGCCGTTCGCGCCGCCGACGCCAAAGCTCACGAGCGTAAGTGGTTTGATACGTTGCGCTGGGATGAACTGTC
CTGAGATTTTGAGACTGACGGTCGTTGGTGGTGCAGTTGGCGAGCAATGCCAAGTTCTGCATCGAGTGCGGCTACGAACTGCCGCCGCGGGTCAAGTTTT
GCATCGAGTGCGGCACGGCCGTGCGCTCGCAGATCGTGTCGCCAGTCAGCGTGGATGGTGTCGGTGCGAGCGATTCAGGGTTCTCGGATCGAGCGGCGCG
AAGCCAGTCTCGAGGCTCTATCAGCACGAACCTGATGGTAATGTGCTGCAGCTTTGCCGTTTTGGGTAGGCGCTTGATATCTCACGCGAGTTGTTGATGC
GTCTTGTAGATCATTGACGAGAACAGTGGGTCGCCAACTGAACAAACGGACGGCTCCGAGGAAGACGCGCCACTCGCACAGAAGGAAGAGGCGGAGACGT
CGCAGGCCTCAGATGACAATGGTTCCGAGGATACAACCAACGAGACCACTGAGCTGATTGCGCAGCTGCAGGCGGAGAACGACAAGCTGCGTCACCGCGT
CGATAAACTCAAGAAAAAGATGGTGGATGCGGAGCACCGGCGGCAAGCGATGGAGGAGGAACATGGACGCGCCATCGAAGAAGCCACCGCTGCTGCGGCC
GCGGCGGCAGCGACCGCTGCAGCGAGTGCAGCGTCTGATTCGGCGCCGTCGAGTACAGCGAGTTCGGGGAGCACAGCGCAGCCGTCGGTGGCCAGTGTTG
CGAATGGGAGTGCTGGTGGCGTTGCTGCCAAGGACCATGACGACTACAAGAAGTTTTTCAAGCTGTTGTCGATGGGGATGCCGCCAGAGCAGGTGAAGAT
GAAGATGGAGCAGGCCAAGGTCGATCCATCGGTCCTCGACGACCCCGATGCGATTATCGGTGGTGGTGCGCCGAGTGCAGGAGCTGCCAGTGCTGCTCCA
GCGGCGTCAGGCGGGACAATCAAAGACGACGAGCGTTATGTCAAGTACTTCAAGCTGTTGAAGATGGGGATGCCGCCCGAGCAGGTCAAGCTCAAAATGA
GTGCAGACGGCGTGGACCCCGAGTTGCTGGACACCCCCGACGCTCCCGCCGGTGGATCTGGCAGCGGCCAGGCGGCACCTGCTGCTGAAGTACAAGCTAT
GACAGTGAAGGAGGACCCTGAGTACGAGAAGTTTTTCAAACTGGTGAAGATGGGGATGCCTGCCGAGCAAGTCAAGATGAAGATGAGCGCTGCGGGGGTC
AATCCGGACTATCTCGACACTCCTGACGCTCCTTCGCCGAACCAAAAGGCTGGTGGTGCTGGAGCTTCGGGTGGTGGTATTTTGTCTGGTCTCCCTCCGA
AGGCAGAAGCTGTCAAGGTCGATCCGAGTGCACTGAAGGCGAGTCTGTCGACGAAACTGAAGAAGTCTGCCTCTGTCAAGAAGCCGGAGGAGCCGCAGCT
TCCAAAGAAGGAGACGATCGCTCCGAATGTGGAGCTTCGCCCGTTGTTCTGGACCCGTGTCCCCGTCAACGTCGTGAGCAGCACGGTGTGGATGAAGCTC
AACGATGCACGCGCAGACTTTGACGTAGACGAGATGGAATGGATGTTCCGCAAGAACCCGGTCGATGCGTCGAAGAAGCAGGACGAGAAGAAGAAGGAGA
CTGCCAAGGATGCACAACCTCAACAAGTGCTTCTGTTGGACCCCAAGCGCCAGCAGAACGTCTCGATTGCGATCGCGCGCTTTCGAATGTCGGCCGAAGA
TATCAAGAGCGCGATCTACTCGCTGGACGGGACTCGCTTGACTTCCGAGGTCTTGAACGTCCTGATATCGATCTCTCCGACGCTCGAGGAGATCGATTTG
CTGAAGAACTACGACGGCGATGTGAAGTTGCTGGGCAATGTGGAGAAGTTCTTCCTGGAGCTGCTGACGATCCCACGCTACACGCAACGCATCAAATGCA
TCCGGTACAAGTTCCAATTCGAGGCCCGTGTGCTGGAGACGCAAGCGCAGCTGGACACGTTGGTCGCGGCCACCGATCAAGTCGCAGAGAGTGACAAGTT
CCGGCGCGTGTTGGAGCACATTCTCGCGATTGGTAACTACCTGAACGGGAGCACGCCGCGCGGTGGTGCGTACGGGTTCAAGCTGGACACTTTGAACAAG
CTGCACACACTGAAGTCGACGGACCCGCGTGTGACGCTGATGCACTACATCCTGCATCAGTTGGAGGAGAAGGCGGCGGACGTGATTGCGTTTGCTGGCG
AAGTGCCGCATATTGCCGAGGCGAAGCGCCTGTCGCTGGACCAGTTGCGCTCTGACTTGTCAGGGTACAACACGGAGCTGGCGATGCTGAAGGGTCAGGT
TCGAGCGTCGAAGAACGACCACATTGACGGGGACAAGTTCTATGAGGCGATGAGTCCGTTTGCGAAGGACGCCGAGGAGGTTCTTGAAGAGCTCGGTCGC
GACTTTAACGGCTTGGAGACGTCATACCAGGAGCTTGTCACGTCGTTCGGCGAAGATCCACGCAAGGTTGGTCCGATGGAGTTCTTCACGATCATGGACG
AGTTTGTCGGCGAGTTCAAGAAGGCGTACCGTCAGAACCAGACGAAGGAGTACCAATCCATTTACGAGAATGCCGCGAAGGCGCGTGAGGAAGCCGCCGC
AGCCGCTGAGGCCGAGAGGCAAGCGCAATTGCAGCGCGAGGCCGAAGAGCGAGCCCGACAAGAGGAAGAGCGTCAGCAGAACTCGAAGGAGACCAAGGCG
ATCTACGAGAAGATCATTGCGACCATCACAGCGTGGGCGGAGACCCACGCGAGCGGCAACGAGGACGCCGTGGTGGAGCAGTTCAAAACGACGTCGCGCA
GCTATGGTATGGGCGAGCTCAGCGCCGACGATTTCTGTGAGCATGTGCGACGGCTCGTGGGGTCGAAGACTGCCAACAAGATCATCCCGAACAGCGCAAA
GCTTCTCGCGGACGAGGCGAAACGCGACGATTTGTTGGCGGCGTTTGATCGGTTCAAGGATCAGGTGAAGCGCGAGAAGGAGCTGAAGAAGCGCAGCTCG
TTGATCTCTCCCCCTGCGGCGCGCGAGCGCGGGCGATCGAGTTCGACGGGGAGGAGACGCAACAAGGTGGCTGTGATCCAGGTCGAGGACGTGGAACCCG
TGGTCGGAGAGGAGGCGCAACAGTTGCACAAGTCCATCCTGGAGGCGGTGCTGCAGGCGTTCGACGGCGACACGAAGAAGATGAAGGTCTTCACGAGCCA
CACGCGCAAATTTGGCAACGAGCAAATCACGGCGCGCGAGTTTTACCAGTATTTAACGGCGTCGTTCGAGCTGGACTTCGTCGGCCGACTCGTGCCGGAC
CTGGCGCGCTTGCTGCAGGACGCGGAGAAGCGCCACGCGCTCATCCAGGCGCTGTGCGAGAGCGCGCCGGGGTGGGAGAAGTTTTCAGGG