Description :
From Genome Similarity Track
Location :
Scaffold_39:126940- 130272
Transcript NameFunction/comments
Physo_135551hypothetical protein
Physo_135552predicted protein

Sequence
3332 bases(100 bases per row)
TGTAGTTTGAAGCACTCTTCGGTCGAGTGCCTCCTATCTTGTGTTCGCAAAGTCGTAAGAGATTGCTGATGCCTCGTTGTCCAGGACCGTGCCCCACCCT
GATGACCATACCGACTCGTTTCGTGGCCGGGGGAATCCGACAAGTGCGTGACTCCAGCAATTGCTCGCGTTCCGCATCTCGGACGGTGTGGCTGTCAGCG
CCTCGCTCACACAGGACGAGCAAAACGTGACTTTCCGTTGAGTCATCTTCATGTTGGGACTCATACAGCTGAGCTTCTTCTCGATCTTGCACGAGCCACA
AACGAACCCGAAGCACATTTTGCAAGCACTGCGGTGGCCCATGATTTTGCCAAAGCGCCACACCCGCATTGGCTTCATGCACGTGATGCAGTTATGGTCC
CCGCTGGGAGGCTCAGCATGCTTCGACTCCGCGTTGCGCTCGCTCAGAGCCTGCGAGAGCTTCCTCATCTCCCCGCAATGGGCGTACTTGACTGTAGACA
ATAGCATCTTGATGAAGCATGGCGCCACAACGCGGCGGATCTTGTCGCTCATCGGATCCATGATTGCCATGACGTAGACGGCCACCGACTTATCCAGCCT
AGGCTGGAAGAAGGAGCACACCGAGAGCTTGGCTCGGACGCGACCGGAGAGGTCGTGGGCTTGTGGGATGTCCACGGAGTGCATGACATGGAAGCCCACG
CTCTCACCGCTGGGCAGGTTCTTGACGCCCGTAGCTTCGACGTAGACATAGTCGCGGTTCTTGACAAAGCCCATCGATCGGCGACGGACATCCAACTCCA
TCCACTTCACCGCTGAAGATTTGAACGGGTCGGCTGCGGTCGGTTCTTTCACTGTTGAGAGAACTGCAGCTCCACTGAGGTCGTCCACGTATGAGGCCTT
GGTTCGTGTGATCTCGAGCGTCGGGCTCATGACTCCAAGCATGACGTCGTCCAGGGAACCGGGAATCAATCCGACGCAGAGAATCGACTGCAGGTCAGCT
TCAGACGTCGAGGTGCTTGCTTCAAGTCGAGAGGGACGCCACCGCCGTCGACGCTCTGAGTACACACGCATCTGGTCCTTGGACTTGGTCAGCTTCCACG
CGTTCGGGTTCACCTTGCGGTTATCAACGTCCCAAAACAGCAGATAGTGAGCCAAGTTGGCATCGACGATGCCCTCGGCGACGACTTCGAGCTCGCTCAT
GTCGGCAGGCGTGAGAGACATCCGTCGAAACGGACTCGCGAACTTTCCCTTCGCCATTGTTTGACTTGGCAGGCGAGTTAATGAGAGGAGCAATTGAGGA
ATGGCCTCCCTTTTTCGTTGGGCGGTGCTATCCAATACGTCCTGGTTATTCATGCTCCGGTAACGATGATTGCCATTGAACTCGAAGGTGTCGCACTGAG
TTTCGCATCGCGCTTTCGTGCGGATCCGAGACCTTCAAGCCAAAAAGTTGCTAACATGTGCTATCTGGTGGCCATGGTGAAGGCTTCGTCGAGACCAGGA
GGTTATGTAGGACAGCAGCCTCTCCCAGTATCCACCCTTTGACAGATGCTCCTTGGTTTCGTTGAGGTTTCCTAACAAGCCTCAAGTCACTAACTTGTCG
CGAAAGATATTATATTTGGTAAGCTTTAGAATTCTTTGACCTCGCTTGGCGGGGCGGAGAACTAAGTTACTTGATGCGGGATACAAACTTGTATTGGCTG
AGCTGTTGAAGTGAGCCCTTCTGCACCATAGCTCGGATCGCGCGTTGGATAGCGTTGGGGTTGTAGCCCTGGGCCTCGAGTCGACTGTACAGCGCACTGG
TCTCCACGCGCGTGCCAATACGCAGAGTGCGGTTGATACTCTGCTCCACCTCCTGTGCCTTCTCGTGGAACCCGCCGAATAGTCCTTGGGTGCCGCCGTC
CTTGGCGGCGTTCATCGTACTCACACTGAACAACCGGATCGCCTCCTGCACGTGCTCGCGCGTGGCCTCATTGAGTAGACGCATCTTCGCGAGAGACTCC
GAGATACGCACAAGGGCTTCGAGCTGACGCACTGTAACCGGAATCGTGGTTTCGCCTCCTTGGGTACGACGCACATCGTCACGTACGCCAACGTAGAAGT
CCTGCAGCGCCTGTGCTGCTCCAACCGACAACCGTGGTGCACAGCGCGTGCGGCAGTACGAGACGAACTTTTTCAGCAGCCACGGCTCGAACTCTCCACC
ACTGGACGCACTTTCACTGGCCGAGGGCTTTCCCGCCGCCGACGCGAGCGCGTTGGTGTGCATCCGCACGACGTGAGCTGCCATCTTCCTGTCTCGCGCG
TCGTCCTGGATATCGCGCACGATGAAAATCATATCGAAACGACTCAGAATCGTGCTCATGAGGTCGATATTCTCCGAGGCAGAGCGCATATCATCGTAGC
GACCGAACACAGGGTTAGCAGCCGCCAGTACGCTTGCACGCGAGTTCAGAATGGTAGTGATACCAGCCTTCGCGATAGAAATCGTCTGCTGCTCCATGGC
TTCGTGGATAGCCACACGATCGGACTCGCGCATCTTGTCGAACTCATCGATGCACACCACGCCACCATCAGCCAGCACCATAGCACCTCCTTCCAGATAG
AACTCGCCCTTGGAGTCACGGATCACCGACGCCGTCAGACCTGCAGCACTACTGCCTTTACCCGACGTGTAGACACCCACGGGGGCAATCTTCTCCGTAA
ACTTCAAGAACTGCGACTTGGCCGTACTGGGGTCTCCCAGCAGCAGCACGTTAATGTCACCACGCAAGATCATGCCATCGGGTAGCCTCTTCCTCGATCC
TCCGGCCAGTAAGCAGGCAATAGCCTTCTTGATGTTCACAGTGTAGTCACCGTAGATCGACGGCGCAATGCTCGTCGCGAGCTTCTCGTACAGCTCCGGG
TGTCTCGCCATCTCGTGGAACTTCTCCTCCTCCGCCGGGGAGAAGGTCGCCTTGGCTCGTCCCGCTCCTTCTTCATCAATCTCAATGCCCACCACGCGCA
GATACAGCGTGCGGATGGCCACAGCGCCGACGCTCTTGCCTCCAGCATTGACCACGGACGTGATCCCCACCACAGACACGCGTGTGCCCGGCGACGCTCG
GTCCACCAAGTGGCGGTCGGCGATCAGCGCCAAGTTGCGCGGCATTTCACCCGTGGGGACCACCTCGGGGTTCTCCTGCAGCTTGAGCGTCTGCTGGTCC
ACGTACTCGCCCTTGTCGGGCAGCACCATGTACGAGTCCTTGGGACAGAGGTCTCCGGCCGCCACGCTGGCGTCCTCCTCGCGGTTGCGGTCGCACACGC
GCGGGATGCTGACGCCGCCCATGCCCGACACG