Description :
From Genome Similarity Track
Location :
Scaffold_36:126909- 130369
Transcript NameFunction/comments
Phyin_T30-4PITG_14552Putative uncharacterized protein

Sequence
3460 bases(100 bases per row)
GTCCTCCGGTAGCAGGCTCTCGTCGAAGTCTACGCGGTCGATCCTATCGTCCGTTGGTGAGGCGATCGGTCGGTCCGGATATGTATTGACTAGCTTCAGC
TTCGTCACATGTACGATCGGGAATAGTCGATATTCAGTGCCGGGAGTCTCTATTCTTGCCGCTTGTCGATCGATCATTTCGGCCGCTCTGAAGGGGCCGT
GCCACATGTGCTCTAACTTCTTAGCGTAACCTTCTTTGACACGATCTAGGTATAACCACACCTTACCACCGATCCTCATGTCATGGAAGCGCACATTCTC
GTTGTGTCGATCTGCTCTCGCTGTTATTGCTTCGTGCAGAGCTTCGTTGACCTGTTCTCGGGTCTGTTGGTGCTAGCGTTGGATGTTATAGCGCCATCGA
CGCGGCTCCGAGTCCTGGCGTCGTGTGCTGCCGAGCGGAAGTGTTGCTTCCAGGGTGGACCTTACGTCCCATCCGTCGATCAGGTAAAACGGCGTCTCTC
CGCGAATTTGGTGCCGTGTTAATCGCGAATGTCAAACGCTCCCCGTATTCCTTCTGATCTACATCTGCAACATACATCTTCAATGATCTGGTCAGTGTCT
ATACCATCCGTTCCGCTGTCCCATTAGCCTGAGGCTGATACACCATAGTGGCACGCTGCCGTTGCCCTACCATACGTTCGAATGCGCGGGAAAAAAAAAC
AGACATGAACCCTGGCTCCCGATCGTGCCTGTCACTTCGCTCGCGCCGAAGCAGCAGAAGACACGTTCTTTGTCGCTCTCAGTTATCGTCTGCCCAGTTC
TCGACGCGCTTGCGTTGGCTACCACGTAGCCTGAGAGCAGGTCTACCCAGATGAGCAGCTCGGTATTGCCCTTGTGTGACTTCGGCAGAGACGGGATATG
GTCCATCGCGACACATTGAAATGGGTACGCTGCTTACATGTTCCCCGGCGATTCTCCTCGAAGTGTCGGACGTCATTTCCCTGTCTCGCAACCCACACAT
TGTCCCACGTAGCGCTGCACACTATGAACAGGCTCCGCCAATGGAAGCGCGATCTCACTCGCTGGTACGTTCTTCCTATTCCTTGGTGGCCGCCTTCCAG
ACTTGTGTGTAATGATGAAGCACGTCTTGTTGTAGATCTTCCGGCACTACCAGTGTCGCCACTCGATCGCGTCTCCCCTTGCGTTCGGACAATAGAAGAG
TAGCCCGTCCTCGCCGGCTTCGTACTCGTCGGCGATTTTGCTGCAAGTACGCGCCTCTCCAGCGCTTAACTTCTCCATATCCCCCAACAGGTACGTTTTT
AGGTCCGCGATCCACTTCTCTTCGTTCTGTGCTTTTCGGATTTGATCTGTTCTCATACGTTGTACGATGTCCAACTGTAGCAGTTCCGGAGGGCTCGCGA
GGCGTGTATGTAGGTTGTAGCAGCCGCTACACATACGCTCGGCGTCTGGTCTTTCGGGAGCAACAGTTCCGGCAGTCGGTTGAGAGCAATCAGGTCTTCT
CGGTTTATGTCCGAGGTAACTACGGTATATGCTTGTTCGCGTAGCCCGTCGCTTGCTAGCCAATCTGCGCTTTGATTCCATTCTCGCTTGACATGTAGGA
ATTCGTGTGCCGGTCACGACCCCAGTCGATCTAGCGCCCGCTGTCGCAGAGGCGTCAAGCCGGGTGCCTTGCACTCGATCTCGCCTCGTATCTACCGGAT
CACTAGGTTGGAGTCGCCGCAAATAATCAGCCGTCCCCTGTCTTGGCTGGACAGTAAAACGAACGCCAACAGTAGCCCGTGGAACTCTGCCTCGTTTACC
GTGAGGTCTAGTGCGTACTTCGCTTCTGCTGCGACCACAATCCAGTCAGGTAGCTTCCATACGATGGCGCTGCACACCTCTCCGCCGCGTTTGACACGCT
CCGATCCGTCGAACCTCACGACTAGCAACCCCTCGCCTTGATCAACCGTTGGCGGGGTTGCGGCGACATGTGAACGTGGCTGCTTCCTTGGAGCAATCGA
CGACAAGATCGAGTCGACGTTCTCCCGAGAAGTGATACTTGCTGCAATGATGCCCAGAATTTCGTCCTCTCCGCGCGTACACTTGATAATTTCTAGCGTC
CACGGCGAAAGCAATGCCGCCCAGTTGCTTAGCCGGCTCTGCAAGCCCGATGATCGCACCAGCCATGCTAGCGTGGAGTATCGCGTCAGCACATTGATTG
ATCGCGTCACCAGCGTGGTGTAACACACGTCCAGTATCCGGAGAAGAGCCAAGATCACCTTCTCAACGGTTTCGTAGGTCAACTCATTGGACTTCAACGT
GCGACTGGTGAACATTATCGGCTTATACGTGCCGTCGTGTTCCTGCATCAAGGTTGCCGAGATCGCCCAATCACTCGTGTAGACAACGATCACTGGCGGC
CGATCGGGGCCAAAGTGTCTGAGCATTGGCGCGTCTGCGATCTTGTTCTTCAGCAATTCGAGCGCCACTCGAGCCCATTTGTTGGCTTCATCCGCCGAGG
GGATCTGCTTCGCATCCCCAGCCGTTCGATGGGGTTTCTGGTCCATCTCGTGAAAATCCACTTCCCGCAGCTCGTACAAGATCGACGTGTAGATAGCGAA
GTCCTCAAAGAATCTACTGTAGTAGTTAAGGCTACCAAGGAAAGACTGCATAGATCACAGTGTTCGTGTGAATGGCAAAGCGGTCAGAGTCTCGAGGTTC
TTCGGGTGGGTTTCGAGGCCGTCCGCGGACACTCGATGTCCCAGGTAGTCTACCTTGCGGCAGCCCCATGAGTTCTTCACCACGCTGATTGACAAGTTCC
AATGGTCGCACGCGTCTAGCAGTCGATTTATTCTGTTGCCGAGCTCGTTCCAGCATTCAGCAGCCACCAGAATGTCGTTGATGTACGAGCGACACCCTAA
CACCGGCGGTCTAGAGTGTACGAGTGGATCCCAGATCTTGAACGCATCTGCCATACCTGACTGGTCGCCTTCTTCGGGGATCCGAAGATAGCCATACAGT
GCGTTGTGCAGAAGAAGCTGGTAGATTTGAGGGATGTTCGTCAACCCAATGGGCATACGCAGCCATTCAAAAAGACCAAACGGCGTAACGAACGCCGACA
CCAGGCGCGCCTGCTCGGCCATCGACGCGACCCAGAAACCGCTCGCCATATCTAATGCGCAGTATCAGAGTGCCTTATCTAGGTCTTCCAGCAGATCGTT
GATCAACGGCATGGGGTGCACCATGAAACATGTCAGGCTGTTCACCACGCGGTGATCGATGCAGAGTCTGATGTCATTCTTCTTGACAATCACCACGACC
GGCGACGCCCACGGCGAATTAGATTTCTTGATGAACTTGGCTGAGAGCCGTCCCTTGATCAAGACGGATAACGTTTCTCGAAATTGGGGTGCAACTCGAC
GCACGCGCTGAGCCACTGGCTTGTGTCAAGATTGCTAACTAAGCGTCTACGTCTTCGGTG