Description :
From Genome Similarity Track
Location :
contig_96:126907- 128288
Transcript NameFunction/comments
g12792.t1KUF92328.1 hypothetical protein AM587_10001284 [Phytophthora nicotianae
g12793.t1hypothetical protein

Sequence
1381 bases(100 bases per row)
GATTCTGTCGGAGGAGGCGGCAGAGGACTTCGACCCGTTCTTCGAGTACGTGCTGCTGGGCGACACGGTGTCGGACGGCGTGCTGGCCTGGATCTCTGTC
GGCGTGGACATGACTCAGGCGCAGACCATCACGGCCGCGGGCACACTGACGGCGGACGGTGGCGTCATGGCCGACTCGACGGGCACGACGACTGGCGGCG
GGGGTGGCGGTGGCATGGGAGGAGGCTCGGACATGGCCGGTGGCTTCGGCGGATCCGTCGGCGGACCGGAGAGTGGCAACGGCAGTGTATCGCTGGGCGC
TTGGGTGCTTGAAACACTGTCTGAGGAAGTGGTCGTGGTTGTCGAGCCCACTTGAACGCGTGCATAGTCAAGCAAATGAACAGTAAAATGTGATGTAGTG
ATACAAGAGTGAGGGCGACCCGCGCTAATAAACGGTTTGTCTACGATTCGAGTGTTGGCGAGGTGGCACCGACTGTGAGTGCAGGCCTGTCGAATCGAAT
CGTTGTTTGGCGCGCGAGTGGTGTGATGTTGGCAACAACGTGTTGCTGGGTCGATTCAATGGACCAGTCGACTCGATTGGTCTGTGGTGGCTTCATTATT
GTCAGGTCGAGGTGACGATGCCAACTTGGATTTAGTATGCCTCAAGTTGAAGTTGGACTCCGGAGCTCTTCGATGTGGCTCTGCAATGTGGCTCTTCAAT
GTGGTTCTTCCAGCACTCTCCAAACGACCACGACTCCAAACGACTCAAACGATCACGTTACGTAAACGACCACCTTCTCCAAACGACCACCGTGCGTAAT
CAATCGACAACGCTTGAGCGCTCGACCGCCTCCAAACACGAACAGCAGCACTTATACAAACGTGAACAAACGGTATTACTCCTGTATCTAGCTTTACAAA
TGCAACACTCCGCACCATACGCGAGACTACATCTACTCCATTCAGACGACGGGTTTCTGGTCTGGAGACGCCTCCGCCTCCGCCTTTGTAGCGGTGGGGT
TGCCGTCTGACTTGTCCGTGGACGTGGCATCTGCCTCCGACGAGTACGCTTGCTTGCCGGCGTCGGCCGACGTCAATGTCGACGGTAGACCCAGGCCGTC
CGTGAGTCCAGAGAGGCCGCTTGTGATGCCTTCGTCGAGTCCGCTCCGTAGCTGCCACTGATGGGTAAGCCCAGCAACGATGGCAGCTTGCCGCCTTTCA
TCAGACTGCTCATGATGCCGTTCGTGATCGAGCCGAGTCCGTTTCCCGTCGGTGATCGTTTGGAGAGTGCTGGAAGCGCCACATTGAAGAGCCACATTGC
AGAGCCACATTGCAGAGCCACATCGAAGAGCTCCGGAGTCCAACTTCAACTTGAGGCATACTAAATCCAAGTTGGCATCGT