Description :
From Genome Similarity Track
Location :
Scaffold_2556:1269- 2900
Sequence
1631 bases(100 bases per row)
CTGATGTCAGCCATGTTGCGGCTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCA
AGACACGCAGAAGGAACATGCAGATACTAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGAGACCAAGTTTTATTAAACGCTAAAAACCTACCTACT
CATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCATTTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTC
CGAAGAAGATGCGAACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCGTTGGCACCAACGGTGGC
TGGGCCACGGACAGCTGCAGGGCAGCAGGTGGTAGAGCCACGGGAGGCTGAACGACAGCAAGTGGTGGATCCACAGATGGCTGATCAATAGCATGTGGCA
GAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCAAGGCAAGCTGAACGTTCAGCCGAGCGACTGGACGCTCAAGGTCCGAGACCTGGTTGTG
AGTCAACAGTGGGTGGCGCTAACCTATCCACAAGGTGAATCATCTCTTCGAGATCGACCGATGGGCGGTGAGCGTGAGCGTTCGCGTCGTGGACGCCGGC
GTCGTATGAACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGA
GCTCCACTTTCACGTGGAACGCCTTGTGGCGTGGCGTAGACGCCAGGGTCGTACCCAGTACTTAGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCA
TGGGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCGTGGACGCTTACGACCGGGCACATCATGTGCCGAAGCGCCACCATGGCGTGCGACAGC
GTCGCCAGGCGCTGGCGCCTCCCACTAGAGTGGGAGCGATGAGGTCAGTAGTTGAGCTCAGGCTCTGACAGTGCCTGCAGCAGCCAGCTCGTACGTATGA
GCGGTGCTCGCAGCGGAAGCAGGAGGTGGAGAGACCTCGTAGTGTTAGGGACATGGTCCCGAAGGAAGCAGGTGCTTCGTGTTGTGCTGAACAAGGTTTC
AGGCACAAGCGTCTCGATAGACGCATAGTTGTTTATGAACAACTTGCTCGATGAGCATGATCCAAATGTGGATGCGCTGTAACAGCGAAAGTGGTGTCCC
GCACGGGGATCGAACCACTGGCCTTTGGCTTGACAGGCCGGAGCTCTACCATTGAGCTACAAGGGCGATGCCCGTACGTCAGTCCGAGAACGGACTACTC
ATGGTATGAGAGGGCTGCGCCCGGGTGGATTTGAACCACCGACCTGTGGCTTTCAAAGCCAGCGCTCGACCACTGAGCTGAAAGGGCGTTGCCCTTAAGC
TTGTCCATTCAAGGACAACAGTTCATGGAACGAGAGGGCTGTGCCCTGACGGGTTCGAACCACCGACCTGTGGCTTCCAAAGCCACCGCTCGACCACTGA
GCTAAAAGCGGATTGCTCTTAAGCTTGTCCA