Description :
From Genome Similarity Track
Location :
contig_96:126899- 128289
Transcript NameFunction/comments
g13312.t1KUF92328.1 hypothetical protein AM587_10001284 [Phytophthora nicotianae
g13313.t1hypothetical protein

Sequence
1390 bases(100 bases per row)
CGACGACTCGATTCTGTCGGAGGAGGCGGCAGAGGACTTCGACCCGTTCTTCGAGTACGTGCTGCTGGGCGACACGGTGTCGGACGGCGTGCTGGCCTGG
ATCTCTGTCGGCGTGGACATGACTCAGGCGCAGACCATCACGGCCGCGGGCACACTGACGGCGGACGGTGGCGTCATGGCCGACTCGACGGGCACGACGA
CTGGCGGCGGGGGTGGCGGTGGCATGGGAGGAGGCTCGGACATGGCCGGTGGCTTCGGCGGATCCGTCGGCGGACCGGAGAGTGGCAACGGCAGTGTATC
GCTGGGCGCTTGGGTGCTTGAAACACTGTCTGAGGAAGTGGTCGTGGTTGTCGAGCCCATTTGAACGCGTGCATAGTCAAGCAAATGAACAGTAAAATGT
GATGTAGTGATACAAGAGTGAGGGCGACCCGCGCTAATAAACGGTTTGTCTACGATTCGAGTGTTGGCGAGGTGGCACCGACTGTGAGTGCAGGCCTGTC
GAATCGAATCGTTGTTTGGCGCGCGAGTGGTGTGATGTTGGCAACAACGTGTTGCTGGGTCGATTCAATGGACCAGTCGACTCGATTGGTCTGTGGTGGC
TTCATTATTGTCAGGTCGAGGTGACGATGCCAACTTGGATTTAGTATGCCTCAAGTTGAAGTTGGACTCCGGAGCTCTTCGATGTGGCTCTGCAATGTGC
CTCTTCAATGTGGTTCTCCCAGCGCTCTCCAAACGACCACGACTCCAAACGACTCAAACGATCACGTTACGTAAACGACCACCTTCTCCAAACGACCACC
GTGCGTAATCAATCGACAACGCTTGAGCGCTCGACCGCCTCCAAACACGAACAGCAGCACTTATACAAACGTGAACAAACGGTATTACTCCTGTATCTAG
CTTTACAAATGCAACACTCCGCACCATACGCGAGACTACATCTACTCCATTCAGACGACGGGTTTCTGGTCTGGAGACGCCTCCGCCTCCGCCTTTGTAG
CGGTGGGGTTGCCGTCTGACTTGTCCGTGGACGTGGCATCTGCCTCCGACGAGTACGCTTGCTTGCCGGCGTCGGCCGACGTCAATGTCGACGGTAGACC
CAGGCCGTCCGTGAGTCCAGAGAGGCCGCTTGTGATGCCTTCGTCGAGTCCGCTCCGTAGCTGCCACTGATGGGTAAGCCCAGCAACGATGGCAGCTTGC
CGCCTTTCATCAGACTGCTCATGATGCCGTTCGTGATCGAGCCGAGTCCGTTTCCCGTCGGTGATCGTTTGGAGAGTGCTGGAAGCGCCACATTGAAGAG
CCACATTGCAGAGCCACATTGCAGAGCCACATCGAAGAGCTCCGGAGTCCAACTTCAACTTGAGGCATACTAAATCCAAGTTGGCATCGT