Description :
From Genome Similarity Track
Location :
contig_38:126892- 140188
Transcript NameFunction/comments
g7069.t1hypothetical protein
g7070.t1hypothetical protein PHYSODRAFT_466927
g7071.t1hypothetical protein

Sequence
13296 bases(100 bases per row)
GAAGTCCAATCGACCAATAAGATCCGGCAGGTCGACCAAGATCTCATCCTGGTTGCCGTCCAAGTCGTCGAAGACGTTTGAGAGCAGCACCTGCTGAACC
AAGGCAATCTTACGCTCAAGCTGCCAATGCTCACACAGCTGCTTCAGCAGACAACCAACGTCACGAACTGTGGACAAACTTTCAAGCAATGGGTGCATCA
GTTCCATCACTTCACCATTCGATTCCATAAGTGCAAAACGACGCTCTAGTGCCGACACAAAGGACGGGTCACGGACGCTCAAATGACCATTCTCCACAGC
CGACGCCATTTTGTTCATAACCACTCCAGAGTTACCTGATCCAGCCTCAAAAATTTGCACAAGCTGTTCTGCAGACAAGTTAATGCCCAATCCTTCGAGG
AAATCAACGTTTACCAGCTCAGGGCACGTCTCGCAAAGGAAGCGGGCTGTTTTACTCTCCTTGAAACTCCACTCTGCAGCAAACAATCGGACCAGTCGGC
CAACCTCCACGAGCTCCCACCGCTCTCGGGCGGCCGAATCAATGAGACGAGTATACAATGATGCGTTGTGGCCATCGTTGTGGTCGATGTCAAAGTCACC
ACCTTCATCGCTATCTGAAGAAGATTCATCCGAGAGTTGAATAACTGGAGCGCCACAGCTTTTTTAGCTGGGTAGGGAGTCACCAGCTTTATGCACTTGT
TTGACGGCAACTTGAGGTTGCCGTGGTCTTCGTGGGCAGGTAAGAACATGTCATCTTTCTTCTTCGCGTCCTCTGCAAGAGAAGCCGCAATCGGTGTCAA
TTGTTTTGTCGAAGCTAGGGGCTCCTCCTCAACTGCAGCAGTGCCAATTATTTTGCTGGTTTTCGCCTTCTTGGAGGCAACTACAGGGGCACGACCAGAT
GCATTTGTCGTGCTGGCGATTGACGTTCTGGATCATCCGACACAATCAAGGTTTTTCCTCGTCTTGGCTGCGCTGGAGCGAGCGTCTTGGGTGATACGCT
GTTCAAACTCGTTGCTTCGGGTGACTTTTTCCGTTTTTTGCGAGACTTCGGTGAAGGTGCAGGCGTATCCGATGGTGAGGTATTTTTCTTTATCAAGTCG
GCGCCCGCACTCTTTGCAGTAACCGCGGGTAAATCATTTTGGACTCCCTTCGAGTTTGATGCCGAGGATCCAGACGTATGGTTGCTGCCACAGGTAGCCT
TCTCTCGAAGTTCTTTGCGTTTTTTCTTCAATTTCTTAATCTTCGTCTTGGATGGATGTGCATGAGGGTCGCTGCCATTGTTGCTGTCGGTAGCAGGTTG
CAGAGCATCATTCTTCTTCTCAAAAGCTCCAACACTCTCCTTTGCCTTCTCCATCTTCGAAACAGCAACGGCCTTGCGCGCCGCACTCTTCTGCTTCTTA
TGAGGCGGTTTGACTATCTGCTGCGTAGCAATCTCCTTCATCTTTCTCAAAGCCTGCTCCAACGGATCCACTCCATTGTCTTCCTCATGATCTTCATCCT
TCTTCATCGCATGCCACGGCGCCTGCACCGGCACCTTGGTCATTTTCACCGCCTCCACCGAATCCTGCTGCTTCTTCTTTTTCGTCTTCACCTTCTTCTT
CTTCACGTCTTGGACAACAAGAGCAACAGTTTTCTCCTGCTTCTTAACGATGGCGTTCGACATACCCGGCACGGTCACGACTCTCGCCCCAGCCGCCCCC
TTCTTCTCCACCACTTTCTTCTTCTCCTTGGGCTTCTTCTCCTTCTTCACTTTGTTCTTAACGAATTTCACCATTGGCACGGGCTCTCCGTCGTCCGCAA
AATTCTTCTTTTGCTTCTTGTGCTTGGACTTGAACAGCACGCGGGGCGTCTCTGGGGCCACTGCAGTTGCTTCTTCCTGCGGCAGCTCGAACATGCGCGC
GTGGAAGGATGCCAGCCGCTCGCGTGCATCATCATCACCGCCTTGGAAGCTCTCGGAGCGCTGGCGCTTGCGCTTCATCTTGGCCAGTGGAGCAATTGGC
TGCGACCGTTTCGATCGTCCGAACCAGCAGCTTTTAAGCCAATGATAATGCAATATTTATATTTCCTACCCAATCAGATGGCTAGTCCGAAAAAGGCAAC
TATTAACTTGGAAAATGAGACCGTCGACGCTGGCGGTGGGCTGGTGATTTTGGCCACGTGCTGTGCTTTAGGCGTGTACGGGAAGCACTCGCGATACACT
GAGAAATGTGGCAGGAAGACCAAGCAAGATCGTCGAGAAATGTTGCGCTCCAACCGCCGCAGTCGCAAGGACAAACTACTCAAAGCCAAGAAGCTCGCGC
GAAGTGAAGCGGTGGTTGCTGAACGGGCTGGGATGACGGAGGAACAAAAGTGCGAGCAGCGAGAACGGATCCGCATGCAACGTGTGGAGCAATACGTGAG
TTTTTTTGCAGTGAAATAGTATGTTTGAGTTGATTTGGGCACTGAACTTCGTTGTGTTTGTGCAGCAAAAGCTGGAGGAGGCTCAGTTGAGTGGCATTCG
CGTGGTGGTTGACTTGGTGTTTGCCGAAGACCAGACAACTCGAGTGAGTTTCACATTTGAGATCTGGTGATAAAGTTGTTGTTGTTGCTGACGAGCTGTA
ATGCGTTAAAGGAGCGTAACAGCATTTTCAAGCAGCTCGGTGTGTGTACGGGTATCTGAAAACTTGTCCGCTAGACAGACTTCTGTCGCTGCATCTCGCC
TCCTGTACGCAAAAACTTGCTGCCGTTTGCGCTCAGCACGGTGTGCTACGTTGGAAGGTATGGATTATTGTGACCTTGTGCTGCAAACTTGTGGGCCTGA
CCATGCTTTGATGCAGGTCGGAAGGCACGAAGAGCCTCTCGAGCAGCTGTATGACGTCGGCGAACTCGTATACTTTCACCGGACTCGGATAACGTGCTTG
AAACGCTGGATCCAGGCTGCGTGTATGTCATCGGTGGCATCGTCGATCGATCAGTTCGCAAGGTACTTAGCGTAGCCACTGAATTCTGATGATAACCTAC
GAATTTGCCAGCTCATCCGTGAAATTGATGGGTTTTCTACAGGGCGAGACGAAGGCAAAAGCGGCTGCGCATGGCATTCAAACTGCACGATTGCCACTTC
AAGAGCACTTTGAACAGACCGGAGCACGAGTTCGAACTCACATCATGAACCTAGATTCTGTGATCATTACGCTGAACGAAGTGGCAAATCATGGCGATTG
GGGGCGTGCCTTTCGGAAAGCGGTGCCGCTACGGATCTCTCGCTCAAAACAAGCTAAGAAGAATCGCGTGGAGAACGATGCTTAACTCGGGCGCTGGTGA
GCGTGTGCAAATGGTGGGAACCTTAGTTAACGTGTTGATTGAAAAATAAAATATGAATATGCATCCTCATATCGATACAACGAGGGGTGATCTGCTCACT
CTCCAACCATGGTGGCCATGCCAGCAATCACGCTTGAGACTGCAGCAGTTGCCGTAGCTGTAGCAGTGGCGGCAGCATTGGTCCAGTTAATGCCTTGGCC
AGCTCGTTGAGCTACCGTCGTATTGTCTGCATCGATAGACTGGCAGTGAGTGATGGCGTACACGAGTTTATCGTGCATGACTTCACGACACGAGTACGAC
GGCAGATCGATGGAAAAGAAACCTGCAATACAACGCCACAGCGTTAGTATGGCGCATTCACGTACAACGTTATTGGGAAGCATAGCTTACAGGTATGAGC
GATGGGCAAGTACATATCAGCACGACCCGCAGCCTTCGGGAGACCCGAAATCTTGAAGTCCTGCGTGAAGTCTGCTGCATGTGTAGGCAAACGCGACCGA
CCCCTGTAATAGGTAAACAGAACAACAGATTAGTGCACTGAATAACCAAACCAAACTTAAATCTGGTGGCTCTTACCAGACGAAGCGAAGGAACGATGAT
TTCTGCTCGGCGGTGAATTCTGCCAAGATGTCCCAGAAGTAGGCAATATGCGGGTCTGTTGCTAGACAGCCGTCGCCGTATATGGTTCGCCGCCGTAGAA
GAGCAATATCTACGGAGGCTTTGCCGCACACGAGTGTCCGCAACTCATGCCACGAGAATAGCCCCAGAGTAGGTGCTGGTAGAATCGTTGCTATACCACG
CGAAATGTCCCCACATACTGGCGCGAACTCAGTAAGACGGTATGTCTCGACTGCTGATGCGTACTCCTCACGATCTTCCCACGTAACGTGCAAATGCTGT
CCCCCAGGCACTAACTCAACTGTCTCCCGCGTACTGGATAGCACAGTAAAACTTGCATCCACGATCTCATCGAACATAGTCTCCGTAATGCCGTGTGCAT
CCAAGTTCGCAATCGTGTCCACAACCTGAAAGCATCCCTGATGGACAGCTTCAATATCGTGTCGTGTTACATTCTGCCCTACCAATAGTTTCCACACCAC
GGGCGGAAGATTCAGATCCAATGGTGTTTTAGTTCGCACAGCCACTCCTGCAAGTTTGCCGAGGAACTCGGCCATCTGCACCCGTCGCGGGTTTGAGCGT
AAGTGTGAGTTTGGAACGAAAAGCTCACGGTTTTCGCCCGTGTTCAGCAATGCGTTGGGACACTGTCGAAGTACAGGCAGCAATGGCGTACGGGTTTGCA
ACTCGGAGCTCAGCTGTGCCAAACACTCGCGGTACAGACCGCCGAAATCGTCTCCAAATTCGCCGACAAACTGGCACTTGAATGCACGGTCAGCCCCACG
TAATAGAGCAGGTTGCAGTCCGTGAAGTTGCTCGAAAGTCTGGGCGAACACACTATCCCGCTCACCAGCTTCGCTAGACAGCGGATCACCACGCTCCGAT
AGTTCCAGTGCATCATGAGCACGGTTGCGATCGACTTCAATCTCTGGACGAGCTGCTGCTGGAGCTTGCTGCTCTTTGAGGACTCCGAGCCACCACGCAA
GCTTCACGTGCTGAAAGACCACACCACGAAGCTCTCGAGCCCCACGAGCTAGCAATGAGTGCTCATCCTGGGCTGAGAAGTCGATAAATGCCAGTGATGT
CTGCAAACGGCAGTTGAAGTTACGTAACACCAAAAATCGGCGTTGGAGTGTCTCCAAGGGTACGCCTCGCAGTACCGGGAATCCCTGTAGTTGCTCTTCG
GTTGGAACAAACTCCTCGGGAGCCATACGCAGTGGGTCACAGCTTAATAGCGCCTCGGCACGAGTCTCGCATATTTCGTTTACGAGCTGCACAAGAGCGC
GATCCCGGGCTGGGGTAAATACACGCTGGGATGCGTGCAGGTGGCGAAGCTTATCACCGTACTTGGTCGCTAGTAGCCGGCGGCCTGTTACTGAGAATTC
TGGGACGGCAGTGAATGCAACACCCCACTTGGTGTCTCCGGACGACTGCTGTTCCTGCTGTTGCTGCAATAAACTCGTCACATCACCAGTAACAACCTCT
TCAGCGGATCGAACCGCGTCAGTATCTCCCTGAGCAGAGGGCGGAGGTGGAATTGTGCTTGAATCCAATGCTTCATTTTCTAAGTCCTCAGACAGCGATA
AGGATTGATCATGCAGTAATTGACGGTGCCGTGCGCGGCGTGCCATTGCTTCTGCTTCTTCGCGAACGAGTGCCTCCATTGCGTGCATGTTCGCCAGAAT
GAAGTCAGCAGCCTGCTCTGCATCGTCTTCACAGTGGCGGAGCGCGTAGACGCACCATTCCATAGGGAACCCCATTTGGCTCAACGCAATTCCCAATTCC
ATTCGGAAGTTTGGAATTGAGCCATCACCCAGGCTTCCTTCGCCAGCAAATCCACCGAGAGTGTCTTCTTCTTCTTCACTGTAGTAGGAATCCTCCCCAC
TCGCCAGTCCGCTACCGGTTCGAGGTAGTCCCGGTTCAAGACCCCCATCCTCGACTCGGTGTCCACCGATAAGATCGATGGAGTCTCGCTGGTTGTACAA
TGCAAATCCAGGGTAAAACGTACCCTCAAGTTTAGGCCCAGTTCCACCAGGACCAAACGCAACACCCAAGTCCTTTCCATTGAGTGCGTAGCTAAGCGTA
CCGCGCCGCAAATCAAGCGTGAGGCGGACAATATCTCCAGTCTTAAATTTGTCGCCGTATGTACCACGCTGCTTGCTGCCATTGTGCCAAAGCGCACGAT
TGCCAATCCAGCCCCACCCGCGGTTATCTTTGCCCAAGTAGGAGTCTAAGCGTACGTCGCGACGAGCAATCCCCAAGAAGATATTTGAGCTTGCTGTCAC
AAACGTAATGCGTACTTCCCAAATGTGCACACCTCCATCAAAACGCGCCACACCAATACCTGTTTGCCAGCCTTTATCACGTGCGAGAGAGAGCCGAGTG
TCTCGTGCTTCAAGCTTAAGATATGGGCCTTTACGCACACGATCCACACGACACTGGAAATTAGACTGCACGGGGAACCGCCACACAAAACTGTCTCCAT
CGATGGTGACTTCCTGCCCTCCGCAGGCCCCTGTAAATGCACGCACTTCTGCTTCGCCTCCTCCGCTGCCTTCAGTGCCTCCTTCACTTCCAGCAGCATT
TCCACCCTGCAGGATCTGCAAGCAATGAGAGCTAGCTGTCTCACTCTGAGGGTCTAACCGCACGCGAATACTGGTAGCAAGCGGGATACTGACGAGTGAC
TCTTGTAGGTCGAGATCGTATGGATGTGCACTCTCTACGCGAATACACACATCCTCTGAAATGTCTGACAAGAAATTGTCAGCCGAAAGCATAAATTCAT
CGGGTAACTGAGCCTCAATGGCAGGGTCACTTGGTGTCCCTGTCTTCTCACCATCAGCGTTCACTTCATCAGACCTCGCGGGATCCATTAGCGCTTTCAT
CACGCCATAAACTTGACTCAGAGGCTCAAACCACTCGAAAGCACTCATAAGATTATCACAGTCAAGCGAGTGGAAGCGGAAACTGAAGTTCGCGTTCTTC
ACTGAAGCTGTCGCTGTGGCACCCAGGTTGGCGAGCAATTTGCAGTCTGCGTTGAAAGAAATGGTAGGGTGTAGCAGTTGTGGTCGTGAAATACTCGAGA
ATGCAGTACCCAGCAGCTGGCCATTCTTGCAGAAGAAAAGCTCTTGAGTATCTAGGCGCAAACCACAGCCAAAAACATCACCAGGGCTTACAGCACCTGC
AGGTTCAACCCAGCGCCAGCGATCCACAAGAGTGTCACCAGCACACAACGCTTGGCCGTTTGCTGGAGCAAAAGAGTAAGATCGAGAGCCGTCAGCACTG
CCGCCCACCAATACTCCTTCAAGTGGGAACGACGGTGGTGAGAAACCCAGCGCGAGCGAGCCTCCCATTGTAGTGCTTGTGCCCCACTCCACGACTGTGA
CTTCGAAATACACAATTTCGGCTTTACCCTCATCTCGCATTGTCATCATGAGAGCTGGGGTATGTTCGAAGCGGCAAGAGTACACCTCTCCGGGAGGAAC
ACCAAGTCCTTCAGCTGCCAACGCTTCTCTCGCCGCCGTGTTGCCGCTGTCTTCTGCGCGATAGTCTAGCAAGAATTTACGCTCTTCGCCAGATAAATGA
CGACTGACCGCCATTTTGGAAGAATGGCTCACCAGCATCTCCACGAAAGGCTGTTTGGAAAAATGGAATCGGTACGGTAGGCTCAACGAGCCCCCTCCAT
CTCGTTCTAAACAAGCGGCGAGCTCTTGTATACGCACACCGCGTTGCTGATCCTCGACAGCAAGCATCAACTCTACAAACGCCTGCAAAAGAGCATGTAA
CGTAAATCCGCCGTCTTGGTCTTGGCTCAAAGCCATAATCTTGGAGCGACAATAAAGTAGAGCTTGCTTGTCATACCATGTGCACCACGCTGGATCACCG
TAATGAGACCTCGTACAAGTGCGACTGCAGCCTGCCCACTAGACGGCTGGTTTTCACGCAGAACTTGCTGTACGAGAGTAAACAGAGCCGCCGGCAGTTC
GGGGCGTAACCGTATTGAAGTATTTTGTTTCGCCGGCTTGCTAGATAGCACCCGCTGATATTGCAGTAGCAGCTCGAGGAAGGCGAGCACATGGTCCACA
CTTATTGGTGCACACAGAACCAAGTCTTCATCTGAGAGACTCACCGCGAACGCCGTGCTGGGTTCAGCAGCGCTAGTTGTCATCAGTGTAACAACCGGTA
GAAGCAAACCAGTGCTAAACTCCGACTCCACTGCCCAAAGAGACGTTTGAACAACAACGTCGTCAGCAACGGGCAGCATTAGCTGCATTCGAGAAGAATC
AATCGCCTGGTTCTTGGTGTTACGACTATGTGGGGTCGGACCATTCTCGCCGGTGGCATCTTCTTCGTCTTGAGCTTCATTCTCGACTTCAATCGTCGTC
GGAAGCTCAACACCTCCACACCCCTGTGGAAGCAGGTGAAGCTGCACGCCAAACACAGTGAAACGAATTAACACGTTTCACAAGGTCTTCGCGAATACAA
CGTGTGCTGGAGACATCTGGAGGCTCAAAAGGGTCTTCCTTGCTTCCTGCTACGCATCCTAATGCTACGTACCCAGCTGGTGCAACAGGCCACCAGATAG
AGCGCAGCTGCTTGCGTTGAAAATCCGGATCACTTTCGGAGTTCTTAGGCAAGCCTTTTCCAGTAATATCCACACGCTCAAAGCTTGTAGGTGGGGCCAA
AAACTCTTGCTCATCGTTATCGTAAATCAGTAGCATTGGTGCATCAGGAGCACCGTTACCACACTTCACCACATCGCCAAGGCAGAACCATTTATTGGTA
GTGTCCGATGCAGCCTCCGGCACTGGAGGTAGCGTCGGACGCCAAATTGTCACTGCATGATCTGCAGCAGACTTCATCCAGCTATTGTCACTGCCGAGTG
AAGACGCGAAGCGTTTTCTCCACTTGTGGCGATACTTTAGTAGTGGGTCAGGTGGTGGAATACTCCACAAGCGCTCGTATGTGTCAACCACCATGACTTC
AAGGCCGCAAGAAAGCAGCACAGGTCCCTTCGGGAAGCACCGTCCGTTTTCCGATTTCGAAGAGGCGAACTTTCCCACCCCAGTGCAGTGGCTGGTGTCG
CATGCGTACGCGAAAGAACATGCAAGATCGTTTCGAACGTGATTGCATCCAGTGTGTTGGGCTGGTACAAGTCATTGACATCCTCTCCAGCGTCGACCCT
GTTCTGATCATTCTCAACAAGGGATTCAACAAGCTGAGTAATGCCAGACCAGCCTAGTTTTGCAGGGTGTTCCATGACTTGGTCGATTGATCGCTGCACA
GTTGACAAATTTTGTGAAGAGAGCAGGTTTGATACCAAAGTTTCTGTTGGAGAGCGTGCCATCACTTCGCGCACCATGCGCGATAGGATCTGCTGAATCT
TGCCGTTCTTTTGCGCCTTCGGTTGTTGATGCAACTGATACTCTGTTTCGTGCTGCAAATTCAAACTCGCTTGATGGGGAACGCTCAAAAGCGTAATCAA
TCGCCGAAGTACCAAAGGATTCCCAAGATCACTGAGAGGTGCGTCTCCGGTCTGTGAGGCATTTCCGAAGAGCCGTACAATCTGGACAAGAATTGTGCGT
GCATGAATAGCTGCGAGGCGCTCACATAGTATCTCTTCTTCACGATCGATCTCAAACGCGTTCATTTGTCGTACCGCATCGTCAAAACTGCTGTTGCATT
CGCTCCAGAGCGTTAACTCTGATTTGCTGAGCATCAATTCCAAACCGGCACCACCAGCGTTATCCATCTTTTTGGTTTTAACAGGACTTCCCATCGCTCT
GCTAGCAGCACGGGGAGGCACAGGAGGGCACAGTGCACTGGATTCTGTGAGAGCGTAGCTTGGGTTTTCGTCTCCGATGTCCTGAAAGTTTACCAGCGGC
TCACTAGGCTGTTCCGCAAGTAGGGTGGCATCCGTTGTAGTGAGAGATCTGGGCGATGACACTGAATTTTCCAGTTCTGCACTTCGGCTTGAAAGTAGTA
AGCGTAAAGCATCGCCGTAGCTGTTATCTGTTTGGCGTAGAGCTTCAGCGCACACTGACTCAGATCGACCAATAACCATTGCTAAGTGGCGCACGTTTGA
AGGGTAGCCACGCTGTGCGGTGTTGCAAAGTTATAAAAGTAAACGTTAGACCTATCATCATATGCACTTCTCGCAAAAATACTATAACAGATACTTACCA
AGTGAAGCCCACGACTTTGCTGAATCACTGCAAATGCTTCATCCAAGACACCAGCCGACATGCGAAGAGCTTCTTCGCACTCAATCGCAGTGGTCACTAG
GTTGGCTTCTTGAACCCGTGCAAGAAGCCGAAGTGTAAGTACTTGCACGTCCTGTAGGCCTGATGCCGCATTCTGTTAACACGATGACAAATCGTTAAAT
TAAGTGCTCGCATGATGGCAAATGTGTGAAGAATGGAAACGTACTGAAGGTGCAGCCAAGCCTGTGTCACCGTTGGAGCGTAGAACGCGTGTCTTCGCCA
ACTCAATAGGAATACTAGGGCGCTGTAACGATGACTCACGGTTTACGCTGTCGCGGCCTAATGCGATACGAAGCATGGATCCCACCCCGCCTTCCTGGGC
TCGAGGCGATGGGATAGCGGTGGGCTCATTCGGAGCGAAACTTTCGCGCTGCTGGTAAGATGCCGGAGACAAGATGCCTGCTGGTACCATTGTGGAGTAC
ATATTTGCTGTTGGGGGTCCTACCGTAGGTGTACCTGGGGCTTGTAACAACGAAGAGCGTGGGGATGTGTAGCCACCAGCTCGAGGTGAATCCACAGCAG
GATTTGGTGAAATGAGTGCACGGGACATCACTCTCAGCAACAGACGTTATTAAACGAAGCCCCTGGGTTATCGCCTGACGAGTCTCCGCTGAGGTGGTAT
TTCCACGAGTCCCGCGATTCTGCAACTCCGCTGGGCTCTCGATACTACCTGTGGTGTACCAAGTTGTGGCTGTTGATACTCCTGGCCGGGGATCAAAATG
TTCAGATCACCTGGGTTCTGTGGCGCAGTGACGATAGGAGGCGGTGCGTGGCGACCTCCGATACTACTTCCAGGGGCTCGAACCTGGAATTCATAAGTCA
CAAGACCACCTCGAGATAAAATCAAGGATATCCGGGACCCCGACGTGATCCGAGTGCTGGATCCATGAATACGCACACCATTTACAATAGTACCGTTCTT
GCTGAAGTCTTGAAGCTCAAATTGCTCTTCACCTCCTTCCGTTTCCCGCCGTAATCGACGCAAATGGAAGTGGCGACCACTTACACTGCGATCGTTTACA
ATGAGATCACAAGCATCCGCGGCGCGACCAACCCGTATTATAGGAGCCGTTAGTGGAAACGGTGCATAATCGATGGCCGAATGCCCAGCAGCACCAACAG
CATGTCCGTGCTCATTTTCACTCAATGGTGGCAGGGGAAGTAGTACACCCCATGCCCCAAATGGAAGATCACCATCTCCTGATCTGTTGGGCCGCTGTGC
AGCCCCACGCAATGCGCTCGATCCGAAACCAATTGGAGCAGCACCCGCAAATGAGGGGTGACTTATCTTACGGCGCGGTGACTGTATGGCATCTATTCCC
CAGCTTAAAGCATTTTCGCTCCCCAATTTTCGAATAACTTCGTCGCGCATTTCATCTTCGTAATGATCCAAAGCAACATCGATCACCTCCTCAGTATCCA
AGAATATTTGTCGCTGCTTTACGCATAGCCATCGTTTTTGGAGAGCGCGTGCTGTTTCAAGCACTACTACGTCTGACTTTCCTGCCCACGACATCGAGTT
CTCAGAGGAAAGCAACGTGACCACGCTCGTTACGAGCTGTGAGTCCAAACTCATTAACGTAGGGCTTAGAGTTGTAATCTGCTTCAATAAGGATGACAAC
GCCTTTGATGACCTCCATCGCATTTGCTGTTTGTACATCTTGAGTCGCCTCAATATTTTCTGCACCGAACTGTTCTGGGGAAGTGACAAATCGTAGTGCA
TAGTACCCTCTTCATCAAAACAAGAAAGTGAAGAAACCATCTCCGATAGCGTCGTGATAATGCTTTCTACATCATCGAACATGTCCACAAGAGCTGGGAT
GCGCTCGACTACCTGGAGCTTGGAGAGTGGGAATGTCTGAGTTCGTGTATCTGGTGCAATCAACGGAGAAATGGAGTTTTCAGGACTGGAATCCACAACT
ACATCTGCTAAGAGATCTGCTGTGCGTGGATCTCTCGTGATTCCGGAGAGGACGCCCGCCCTGCTCGAACCTTGGTCCCCGGCGCCTTCAATGGTGACGG
ATCCGCTTTCTCTGAACATTTCAATGTGTCCACCAACAATGCTCACTGCCGCAAAAACTGTAGCCAAACCCTCAAGTGCATCTTTGGCCTTTTGCCAGAG
CATTAGCGAATGCTTATCTCGAGTAATTGTCTGTGCTTTCTCCGTGTCATTAATCGAGTCGTCGGTTTCTGGCGACGAAGTAGTCGACTCGGGTTTTCTT
AGACCCGTGGAATCATTCTCTTCCTGGAGGCCATCAAGCACTGCGGTTTGTAGAGTCGTGGTGTCTGCTTCCTGGATATTTGTGTAATATGCACAAATGG
TGTCCAGCAGCTCGCATACCTTATCTGATTTCGTAAGCCCTCGGTTGATGGCGGCATTGATCGCGACTTTCCAGGCTGGATACAGCGTAAGATAGCGCAG
AAGTGCGACGGCCTCGGAAGCCTTCGCTTCTGCAACGTGAGCTTTCTCGAGTGCAGCTTGCTGAATTTGACTAACCTCAGTATCATTCGCTATACAAATT
CCCTTCAAACACCGTGCTGACTGGCAAAGAGCAGTATTTGAACACTCCAAGCCAAGTTCATGGGAGCAAAGACGAGGCCGGAGCAGGAGAGGAAGGCCCA
CTAACCCCATCAGCATACTTAGAATATCCCTGAGAGGATGGGGGCAGCCTGCTGGGAACGGTAAATCTTGTTGAGCGCTGATACAGAATGCTGCGGGAAT
ACTAGCATCGCCAGGCGAATACATATAGTTGCGGAAGCCAAGTCGGAGGAGTTCATTCCACTAATGATGTGGGTAGTCACCTCGGAGTTGGCTGCAACTA
TCGAACCTACATCAGTATTTGCCGAACCACACGCGAGAAGCACACTTAATATCTGGTTCCTGTAAAAGTGGGCGTGGAGCGAATTGAAATCCACTCCCGT
GAGAATCCCCGAGTCTGGCGAAGATAACGTAAACTTGGAACCAAAATACTGCAGTAGCCCAACGCACACTCGTTTGAGAGATACGCTAGTGCCCAGCAAG
CTAGGCCCTGTAGCCGTTGTAATCCCACTTGTGGCAACATAACCGGCATCATCAACTTGCAGAAACTGCAGGTTTTCCAGCAAAAAGCGTATGAAC