Description :
From Genome Similarity Track
Location :
Scaffold_62:126831- 128567
Transcript NameFunction/comments
g17434.t1XP_009530093.1 hypothetical protein PHYSODRAFT_545797 [Phytophthora sojae
g17435.t1hypothetical protein

Sequence
1736 bases(100 bases per row)
CGAAAGCGAAGCACAGGCTAAGGAGAAGGCGGAGACGACGGTAGATGCCGCGTCCATTTCGTACGGTAGTTTGCTGCTTGACGACGGTAGCGCCAAGGAC
GACAAGCCCAAGACTCGTAATGGACAGGGCGTCCGTGGCATTCAGAACCTGCTTAAGAAGGCCGAGCGCAATGCTCAGCGGCTTGAGGAGTTAAAGAAGA
CGGAGGAGGGATCGGAGAAGGTGAAGGCCAAGGGCTGGGACACGGCCCTCCAGCAGGCTGCAGGCCAGGTCGTGATGGACGACCCGAAGCTGCTTCGTGC
CAAGCTCAAGAAGAAGGAGAAGTCCAAGGCCAAGAGCACCAAGGAGTGGAAGGAGCGAACTGCAAAGCTGGAGGTGTCTAAGAAGGAGCGACAGAAGAAG
AAGGTGGCGAACAGTCTCGGCCGTGGCAAGGAGGCTGCCAAGCCCGCCGAGAAGAAGGGCCGAAAAGGACCGGTACGTGGTCGTGGAGGTCAATCGTTGT
GTGGAATTGTCAACTGACATTGCTATGTGTGTGTCCAGCGCGCTGGTTTCGAAGGCAAGAAGGGCGAGGGATTCCTCAACGCCGACAAGAAGGGCGGCAA
GCCTGCCGGCAAGCCCACTGGCAAGAAGTCGGCAGCACCTCGGAAGTAGCTCGGAGCAGAAGCCGAGAGGCTCCCAGGTATATAATATAGACTGCCAGTT
TGCACCCAGAAGAGAGTGTATTTGTCATATAGATAGACGAGAGCGCTGGGAGGGAAGCTGCAGTACCGAGCTGGATCCACGGACTAGAGGATGCTGCAGC
TGCCACCGCCCTGGCCGCTCTGCTGCCACGGGTTTGGACCGCCGTCGTTCTCTCCGAGGAACGGGTCGGCCGTGGTCTGGCAGTACTCGGCGACTCTGGA
CAGCAACAAGTGAGTCTTCTCTCGGTTATCGTGATACATTTAATGACCTCACTTTTTGGCCGCTTCGGACGTAGTGCACGAGGCTTCGAGCGTCTTGAGG
TCCAACTCGAGCCGCGCGATCTCCTCCGCGAGTTTCTTGGTGGCTGCGTCTGACATGGCTGGAGCAAAGAGTCGTGTGGAGCAGCGAGAGAAGTGAAGAA
ATGGCGTCGACTCTTGTGGAGCGCCGCTTGTTATTTCGATCTTTTCGTGGCGGTTCGTAGAAAAAAACTGCTAGCGGGGAAGTTTGCGGGTGCTGCCCTA
CGAAAGTTTGTGGGTGTCATCATAAGTTGCATTAAGCGCGATTTACGTTGCGTCAACCTTATTTATAGGAATGGCAATATCTACCTCGCGCTTCACTGTG
TGCGCGCGGCCAGCAATGCGATGAAGGCAATTGCGTAGGTGGCATACAATAAGTCGGTGGTGCGCTAAATAGCAACCTGTAAATGCTGATCTGTGCGCCT
GCAGCATGCTGAGGCCACCTTTTGATGAGAGAGATCTGGAAAGACAAGTTTGTCAGGAAGCTGCCAAGGTTCTTCACCGTCCCCAGTGCCGCTTTCAGAA
CATCCTGCTCCATCATTTCGGCTTCGAGAGATCATCTTCAGCATCGTCTGTCGGTGGTTGTTGCGCTGTCGACAGCTTGTCTGTCTATATAGATTGTGAG
GACGGAGCTCCAAGTGCAACCTTCATTACCTTCACTGGGAAGTGAACTCGACAGTGCTGGATTCGGTCTTCCAAGACTTTGGCAACCACAACAGCACCGA
TGGGGGCATCGGCACAAAAGTGGATTCCCCACAGCT