Description :
From Genome Similarity Track
Location :
Scaffold_7:12683- 14719
Transcript NameFunction/comments
g5750.t1hypothetical protein
g5751.t1XP_009518137.1 hypothetical protein PHYSODRAFT_487796 [Phytophthora sojae

Sequence
2036 bases(100 bases per row)
GAACGTGGTGGGGCTTTTACTAAGCGCAACACAACTTACGTTGTATGTCATCTACCGTCCCAAGAAAGAGGTGTCGGCAGCAGACACGAGTGGAAGCGAA
ATCAACGCTGTGCTGGGTCTGGAAACGGGTATTTCTGAGCAAGTTGCCTTACCAAAGAGTCCAGCATTTGCTCTACTAGCGTCACCCAAGCATTTTCTGA
AGTAGAAGTCCAACATTATTCCCCCGAAGGGCGTCCTATAGGTACTACGACGAGGTGTTTCTGGACGAATGGGGATGGAAGCTGAAGCACGTAGCCACCT
GAAATTACCCCCCCCCCCCAATCCACGAAAAGATCCTTTGGTACACTTATTTGTTGAAGTTTAACCATAACAGCCGCAACAAGAGCGGGAAAGCTGCTGC
GTCATAACTTCCGTCAACTCACCACGTCCGGAACATCCTACACAGCCACACTGCTTTTTCATTACTCGTCGCAGTACCTCGTGACGCTTTAATGCGTTCC
AAAATTTTGCTCTGCGTCGTGAAGTGCCCCCACTTCTCCTCCGTGAGTCTTCTTTTTATCGTATCACAAAGAACCTTTGCAATCTTGACGTTGTTTTTCG
TAGTGGTTGCGGGATATGCGGCCCTGATTTCCATTGAGGAGCATCGAGCGACAAGGAGTTTCACAGCGTCGATGTGATTTCTGGAGACAGCACTCCTCAA
CGCCTTGCTGACGCTGGATTGCTGTAACTCCACGTCCAGCAGCACCTTCACTGCATCCCGTTGGCCTTCTGCTGCAGCTTCTTCGAGCGCACGACCAAGG
TAACCCCAGCCGCAGTTCTCATGCACGAGGACACTTAAAGTCCCGATGTCTCCTCTCACTGCGACCACTTGAATCCCGTCAGTGATCACATACGGCTCTT
GGTTATTTCCCATTCGGTTGCTGCGACACAGCCACTTCACGACATCGCTATGCCCATTCTTCGCTGCAGCGTTCAACGCAGCACTCGAGCACCTTGTGAA
GTAGTGAGCACGGAGCCACTTCACGACGTTCACATGTCCGTTCACCACAGCCTCATCCAAGGCGGCGATAGAGCATCCTTCATTGCGAACGACGTACAGC
CACTTCGCAATATCGAGTCGTCCTCGAGCCGCTGCTCCATCCATCGCATTCTTCGTCCACTTCCTAGTGGTGCCATGCACACGAACGACGTACTGGCAAT
CGTTGTAGACGGCGGCGTCGATCGTCTCGGGCTTAAGGAAGTCATTGATTTGGTCAACCACGTGCGAAAGCGCTTGAACTCGCCCCGGTAGCGCAAGGAA
GACAGATGTGAGTTGCGGTTCTCTCATAGTTGGCATTTTGCACAGTGACCGTCGTCTTGGTGCCTTTGCTGGGACGTGGCGTCTTGGCACCCACGTTTTC
TCTTTTTCGCAAGTGAGAAACGCAGTGATGGAGTCCACCGCGCGTGTATTAAGAGGTCGTCGCCTAGAATGAACAATGAAGTGAACGCACACTTTACCGA
TACGTTTTTCATTTGAGTCCAGCTTCGGGTACGTCAGCTCTGGGTTTCCAACTACATGCCGGTTTGTCAGTTTTTTTATTGGGCCAGCTCAATTTCCTCT
ACGTTCGCCTTTCCTTCGTTTTCACCCTCGTCTTTCGCGTCCTCCACAACCTCCTCGGCCACCTTCTCGACCTCCTCGGTAGAATCTTCTTCGACTTGGT
CAGTCACGATTTCCTCGTCCTTTTCCTGCTCTTGCTCTTCCTTCTGTTCTTGTTCATCGACTTGCTCGCTTTCCTCAGACGCTACCTCCTGAGAGGTTTC
TTGGGGTTCAGCTACAGGAGATGCGTCTTTGCCACTCTTTTCCGGGAACTGAGAGTCCGCTTCCACACCCTTAGCGGCTTCATCTTCACCCCCCGTAGCC
ATCGCAGTACTGGGTGCAGCTTCTGTAGATACCTCAGCTTCGACACTCTCATCAACAATTTCCTTTTGCTTTAGCTTGGCCAAGATGCGACGTGCGGTGT
CGGCAAAGTCTTCGGCATCATGCGTGGCTGCTAGCA