Description :
From Genome Similarity Track
Location :
Scaffold_61:126819- 136388
Transcript NameFunction/comments
g13919.t1hypothetical protein
g13920.t1hypothetical protein

Sequence
9569 bases(100 bases per row)
ACCCAGTCCAACGCTCCATTCGTTTCTCGGAGCACTTGTATTATTATCTGATCCCCTGCATTTGCAACCGTTGGTAGCGAAACTTCCGACACTGGCGCAC
ACCAATTATTGCATTCACGGCACACTACCAAGCGCGACCCACATCTGATGATATGGTGAACAAACGCAGCAAGAACAGGCGACGGGCCTCCTTGTCGACC
CACAACATCCAGCGTGCTGCAAACCCTGAACGCCGCCGCAGTGAAGCTACAACCTCTACGAAAACGAGCGAAGTTAGCTCTGCCGAACCTGTAGCCGAGA
ACGCCCAGCTTTTACCAAATCCGCTGAGGTTGACTAATGATGGAGATGTTACAGCAATGGAAGAAGGACAGCTCAAGAATGACAAGAAGAAAAGTATTCT
CTTGTCGCCAAGGCTGGATGCTCAACTTGGTGGATACCCACCCGATTGTGGCACCAAGGAGCTGAAATACCTCTCGTACGCCAAACTGGTGCATGATCGT
GGAACGACTCACCCGATGCGTTACTCAACGACCCACGTGGACGCACTGGGTTTCGCCATGCCAGAGCGATATCCGTTGTTTTCCACCGACTTTGGCGCTC
ACTCTTTTCACCACCTGCCGACTGACTCGGTTGTTCTAAGCCAGTATGGCCTCGGGGTCGCGCTTTACTTTAAGTATCTTAAGGTCATCACGTGGCTTTT
TCTTCTGCTTGCCGTGATCAGTGCTCCTGCCTTAGCAGTCTACATCGTTGGCGGCGGCACTTCTATCGCGGAACTTACTGCTCTCGCACGCCAAGACCTT
CCGTCCGTCTTGGGAATTACCAGCATTGGCCATCTCAGCGAGGCCACCAGTGTGTGTGATCAAGCTTTGGAGAATGCCGAGCTGTCACTCACGTGCTCAG
CGGGTGAGATCGGATTTGTCAAGGCAGTGTATTCGACCTATGACACCCAAGGGTCCTGCGCATGCCCCGAGCGCAACAAAGTTGCTGAGGGTTCTGGGAA
GTGCCGAGGTGACGCAGAAGGATCGGTTTGCCCAGCGGACGGTCTGGGTTGTTTTCTAGGCGTGCACCCAGTCTCCCTTCGTCCTTGCTGCTCATTTTCA
CAGAATACAACGACTAAGACCCCATGGTTTGACGACATGCGCATTCAAGCAAATGAAGGTTGCCGCTCTCGCATGGCCCAGCAGATAGTCGAGGGAATGT
GTCTGGGCAAGAAGAGCTGCACGCTTAATGTCAGTGAGGCGATCACTTACGCGTGGGAACCTGATGCCAACTACAGAACCAATTGCTCCAAAACTTCAAC
GATTATCACCATTGATAGCGTCGCTAACATCACCAAGGAGGTGTGTGAAGTGCGTCTGAATGACGATAGCGACTACTCGAAGTGCGATGACGCGTCTCGT
GCACTCATCGTGTACGGGAGGTGTTTCACCACTCGTGTTGACTTATCTAGTGCCTGGAGCCTGAAGATTATCGGTTGGGATTCCATGAGTGTAAGGGAGG
CAGTTTCTTCAGGAGTTTTGGGGTCTAACAAAGGTCTAACGTTGATTTGCTGTTTAGCGGCGCGAGTTCTTGGGGCTGGCGGTAGGGTGTGATATCTCCT
GTAGCCTCGCATTCTTTGGTGTTGTTGTTTGGCTACGACGGAAAGAGAAGGAAGCTGTAAACCGCATTGCCCAGAACCAAATCAAGGCTCTGGACTACAC
CGTGCAACTCGTGAATTTGCCGCACCATGACGATCTCAATCTGCTTCGACAAGAGGTGAGTCCACCATTATTCGAGGTGCTGGATGCACCAAAGCGTCGT
TCATTCTAACGCTAGTTCGGTCTGACTAGATCCGACTACATCTTGAAGCAGTCCTAAGTAACGCGCCACCATTCGCGGTGGAGCTTGATCGTGTGCGTGT
TGCGGACGTCCAATTCGGCAAAAGCGCGTCTCGCCACTTGCGTTTACTCGGTCGTCGTGGAGCTATCGTACGACACCTCGAAATTGCACAGCAGCGTCAT
GAAAAGCTAAAGCTGTTGAGTGGGCGACTGGATGAGCGCGTTTACGCCAGACGCGAGAAGCGACACTTAAAGGCTATCCACAAGCTAGAGACGAAGCTGC
ACGGCTTCAACGTCAAACTGGAGCGGTGGCATGCTCGTCAAAAACAACGAAATATCTCTCAAGCTGTCACGGCTTTCGTGACATTTGAAGAAGAGGAGGG
CGCCCACCGCTGCCTGCAAGAGTACCCGGATCTGGGATGGTTCCACCGTCTTTTTCAACCGTACTACAAGCGTCTTCATGGCAAACGACTTCGCTTTCGC
CCAGCCCCAGATCCGACCGACATCATTTGGGAAAACCTGCATCACCCGTTCTTTGAGCGTGTCTTTCGACAACTGGTACGCTTTTAAAAACCTTGGTACG
AGTATCTCATCGTCTAACGTGCGTTCTCCATATGCTGTCCGGCAGATTGTTGCGTTGATCACGCTCGCAGTGTTGTTTGTGAGCTTCTTACTGATCTTCG
CGGCAAAGGAGCAGAAGACCAAACTCGAAAGGCAGTTCGGCCGACCATCAAGCTGTCCTGTTGATGTTTTGAAAACCGACGTCATTCAAGACGAGCAAAA
CAAAGTTTCAGGGCTCATGCCGTACAAGGCGCTCGTTGAATGCTACTGCAAGAACTTCCTCACCTCTCAGTAAGTTCATCACAGTTTGCAAGCCTTCCAT
TCTCAAACTGTGTGCTCATGATCAGACTTTAACTTTGTGCTTCGCTTGATGCTATTACTCAGCTCTTTCCGCAGCATGATGTACGAAAGCTTTTACAACT
CAGAAACTGGAGAAGATGAAATGCTCTGTCGGACTTGGGCCACAACATTTGTGACGACCCAAGTGCTGTCCATTGCCTCGGTGCTGCTAGTTGTAGCTGT
GAACCTCATTTTGGCTCGCATTCTCAATGGTCTGGTCGCTATGGAGAAGCATCACACGCAATCGAGCCTTGTGGTGTCACGAGTCACCAAAGTCTTCATC
GCGCAATTCTGCAACACCGCGCTGTTGATGCTTGCCATCAATGCGAATGGCAAGTATTTTTCAGCTTCACCGACAAGCATGAGTACCACCGGAGGCTTCT
CAATTGGTGCACTACAGGTGTTGAATGGCGAGTATTCAGACTTTTCAGCGGAATGGTACAACGACGTCGGTGTGGCGCTCATGCTCACCATGATCATCAA
TTCGTTCAGCATGCACGCGTATCTCTTAGTCCAATACATCGTGCTCAAAGCTCGCCGCTTCATCGATCGAGGATACTCTTTCAACCACTCCCTCACCAAA
CAAGACACACAGCGTGATCTTGAGACACTATATCGTGGACCCAAGTTTGATCTCGCTGCACGCTATGCCCAATCGCTCACCTCGATCTTCATCATGTACA
TGGTAAGTCTGAATTGACCTCACATTGTCCCCACGCTGCAAAACTAATCTAGGGTTGCAGTTCTCGGCAGGAATGCCTCTGCTTCATTTCATCGGATTTG
GGGCTATGATCATGACGTACTGGGCCGACAAATTCAGTAAGCTGTCATGGTAGCGAAGACTTTATATCGTCCAGTGACTCACGTTTTCCAATGATCGTTG
CAGCATTTCTCCGTATCGCTCGGTCGCCACCTTTGTACGATGGTCAGGTTGCCACTGCGGCAGGATCTCTGCTTCCTTATGCAGTGCTGATGCACTGCCT
CATTGCCATGTGGATGTTTTCAAACGACCGCATATTTGAGTCGGAAAGTGACGTGTCCAAGGAGGATTCCTCGGTCAACACCACCTTCAGCCCCGGTGAT
GGCATCCCATTATTTGACGCAGCTTATCGAGGTCAGTTAATCTCCCGCGTCACCCGCCCGCAGGTCGTCATCCTTTTCGCCTTCTTCGTGGCTGGCTGCA
CTATCGTGGTAATGCGCACCGTGCTCTTTGAATATGTGCCGGCGCTAGTACGCAGCGTTTTGCCAGCACTTGCTCGATTACTGGAAAATCCCCGTGTTGC
GAAGGGCATCCCTAACTACTTCGATGGTACGTGTGCTTCTTCGAACTGTTCATGACAACCTCTGATTGACTTTTCATGCTTTTAGCCATTCCGACGCCTT
GTCTGCAAGAGAAATTGGCTGCCACGGGCGGTACGCAACAACTTCTGCGGCCGGACCTGCGCGCCAAGTACGAGCGTGCTCTGGTTAGCCGGGTCGCACA
GGAGGAAGTTCTGTCAAAAAAGCGCTCGGTGCGTTCCATGTCAGCGACTGAGCGCTTCAACCAGGTAAACTGGATCGTCGGCTGTCATTCCTATGGTAAG
TCGCTCTTTTATCGCCATCAGCAAGCAGCAACCCTGACCAGTGCTTGTTTCATTCCAGCTATCAGCGACAACAGGGAGTACGTCGCGAAACTTGCCATCG
ACTCGCACCTCTCGGAGGAAATTCCACTCGATCAGATTTTCTAGGACGCAGGAACAACTCTGCCCTAGGTGGTATGGTACACGCGCTGGGCGTTTATTAG
CGGCTTATTTCGTGAAAAAAACTCAACTTTCCCTACTCTCTTCGTCTTGTCGGCCCTTACACGCGGCATCTTGAACACATTTATGCCAGGCAGACTATTC
CAAGGCCTTGGGAGATGGAGAGGAGCCGTCTGCAGTTGACGACGATGGCGATTGCACACGCAGGCCAACGTCTGAAAGGTCAGACCTCTGTCCTGCGCGA
GTCTGAGATCGCGTATTGTTGCTTTGGTAGAAGCCCATCGCCATCTCGGTCTCGCCAGGGCAGTGCGAGAATGCAAAGCCGGTGTTGCGGCGAACGAGTC
GCGGTGAGTCCATCACCACAGCAGCGTCTTCCCCCTTAGCCAAACGATTCCACTCGCGCATCAGATGTGATGGCTCGGGGTAAAATAATACTCGCCCAGC
CTTGGCGATATAGTTCGGTAGAATGGCGATAACCACAGACAGCAAGAGGCCAAGCCAGAACCACGGCTCGCGAATAAGCTGGTCTACCACTCCATAGCCC
ACTTCCGTGTCGTAGAAATCAGCATTGGTCCATCCGAACACAGCACAGAAGAATGCCGTGAACAGGTAGTAAAACACCAGCGTGCCGACAGTTGCCAGAG
CGTTCGTCCGTGTCCAATTGCTCGTCATGAGCGCCACTTGCGCCGTCGAGGCGGTGATCAGGTACGTGTATGACGCCACACCATTTGCCCAAAGGCCTAG
GTCGCGCTTGTCAAACTGAAGCTTTGATGAGTCACTCGAAAAGTACCAGACGATGGAGCCGTTCGAAAAGAATGGCACCGCGTACACCACGTAAGCATGC
CACGCGCCCAATATGCACCAGCCAAAGAAAGTCAGCCAGTTGAACGAACGATTCTTCAGGCCGTTCACGTACAGCGTCGGGTACTGCATCAGCACTGCAG
GAGACACGTCCTGGTTGTACATGGCAATAATCACGATCGGAATCGTCGTAAACAGAGCGTTGTAAAGCGTAAAGAAGATGCTGAAGTACATCAGCAAACC
ACTGTACATCGTCTCCATCGCCAAGAAGAAGTTAGACATCGACAGCGCCACGTTCTTCATGAACGAGAACAAGATCAACTTGGAAATTCTCTTGTAGCTG
TAGTTGCCGTGCACCAAAAGAAGGCGCTTCAGGAAGTGAAACTCCGCGATAGAATAGTCACTGGAAAGAACGGCTTGGCGGCCCTCTTTACCACTGATAC
CGACACCCACATTCGCGGCTTGAATCATCGGCACATCATTTGCGCCGTCGCCGATAGCAAGCGTAATGTTGCCAGGTGAGAACATAAGCGTGGGTTCCGT
AACCAACTTCACCACTGACGCCTTCTGGGCGGGCGAGCAGCGGCAGCAAATCACAGATTTACATTGCGTGGCCACTGCCAAGAAGAGGTATTTGATGTCA
TCATCCAGCACCAGCGCCAACGTTTTGCCATCAATAACCATAGCAAACTCCAGTTCCTCGTCGACGTAGTCACCGCTGCTCATGCTGCCAGTACCACCCG
TCATCGTATCAGTTTTAGGCTCGAAATCGTGGTCGCACAAACCACGTTCGAAGCTGTTTTCGGAAATGTCACGGTTCGGCAGCGCAGGATACACTTCATC
GAAATGGACAGGGCTGTCCGTCGGTGTCGTATCATGTTCGCGTCGTGGCAAGCGTCTCCTCTTCTTTCGGGCCTCTGCTTCTTCGTCGCGTCCCACAAGT
GCCAGTTTTATAAGATCCCACAGATACAGAATCGCTCGCTTCAACGCTTCCCACAACACACTGAACGCCGACGAGGTCTCATCTGATCCCCATTTGTCTT
CAACAAGGTCGACGTACAGTTCTTCCAGCCGAGTACGAAGCGAGCCCTTGTCGCGCTGGCCCAGTACAATCACATCCATATTATCATCGATCACGTGTGA
CGACATGCCAATGCTGAGCGCTGTTTCCTTCTTGTCACCCGTGAGCACCCAGAACTTAATACCAGCCTTGCGCAAAGCACAAATAGATTCTTCCACACCG
TCCTGCAGTCGGTCTTCGATGGCTGTCGCACCGAGCAGTGTCAACTCAACCTCAATGATAGCCGAAACCTTGGCAATTTTTGCGGCACGTCCCTCCATCG
AAAATTCAGCCTGTCGGTATAGGCTGCTCCACTGTTCATACTCCTCTTGGGTAAGGCGACGCATTGCAGTGGTAAGAGTTCGAAGGCCTTCCGACGCGTA
CTCCTGAAGATGACCACGCGTCACATGCGCCACACCCTGTGGCTGGGTCTTGGAAAGGAGATCGAAAATGACGTCGTCTGCACCCTTGCAGTAGAGCACA
ATACTACCATCGGGAAATCGTACAACCACTGACATTCGTTTCCGATCGCTGTTGAACTCTAGCACGTTCAAAATCTCAAACGACATCAGTCTTCCTTGAA
TGAGAGCATTGCAAATCGGACCGTCGCGTGATTCAAGAACGTAGCCGAGGTCACTCGCAGCCTGTACAAGTGCCTCCTCGTCAGGGGAAGACGCATTGTA
TTTGATAGTTGCTGTCGGCGCCGAACAGGAGTCGCCAGTGGATGTAGGCGATGCGGGAACATTGGTCTCGGGTATCACGGTGTTGCAAATGGTAAGCAGT
AGTAGGAAATCGTGGATCTCCTTCTTTGTCGAGTGGTTCGAATTGAGACGCGCCATCAAGCGGTTATCATTGAACCGAGTTCCAGGTCGCGTGGGCTTTG
CAGGGTCTACTTCGATGTCATTGTAGCGCAGACCAGCCACAGTACACTTCGCAAAGATCATTTCGTTGCAAGTGAGTGTGCCTGTCTTGTCCGAGAATAT
ATACTGAATCTGGCCAAGATCTTCGTTGATGTTGCTGTTGCGAACCTGAGCTGGCGTATCTGTCTTGGTGTCGTACATCTCGAGATCGTTTTCAATGTAA
CGTGCGTGAACAAAACGCACGCCTTCCATCGTCACGTACATGGAGAGCGGGATCAAATTGTTGAACAGGATCACGTAACTCAAAAAGATGTAACCGTTTG
AGTCTTCCTCGATGTACCAGGGCGTTGTCTCGTCAGCCAGGTCAAGGTTCCAGTTGTTGTTGCCCAACGTGCAAGCAATTGAAATTCCAAACAGTAACAT
GAGCACCAGAACGAACATGGTGTCCAGGGTCTTCTCCACAAAGCTTCGCTTGAGAGGCACAGCCGTGGAGTTCATCTGGACCTTCGTCTCCTTGCCCGTG
TAAATCACGAGTCCCAACGTCCATTCAGAGTTGCGGCTCTCACTGCCACGCAGAAGCAAGTTGTCCATGGTCAAACTTGATTCGTTGTCGTCGTTGTTGG
CATCTGCAACCGCATCGTCTGCTATCTTTCCAAGTCTCAGCACGCCGTCGAAATAGAACAGGTCCTTGTTGGGCACGTCGCACTCCACCTGGAGTTTGTA
CTTCTCCAGAATCTCCTCTGCAGTCATAAAGTGCTTCGTGCAGCTGGCTACCTGGCGGATCTTCAGGTTAGTTTCGCCATCCAAGTTGGCCGTCTCAACG
TAGCATCGGCCGTCGGGTCGACTTGTCGCCAGCAAAATGCAGTCAGCCGGAACCTGATCGCCGTCCTTCAACATCAGTACATCTCCCACTTCGATATCCT
GCCAAGTGCCATCGATGTGCATCACCTCATTCACAACGTCGCGGCGAATAATGTGCGCCGGCCTGGAATTTACCATGGCGTCTCCCTTTTGGCGACGCAG
GTCTTCGCTCACGTCCTTGAGTGCAGACGTCGCGAACACGATCAGCAATGGCGTCAGACTAGCCACGGGACTCACTGGCGAAAAGTCGAAGAAACACAGC
GCCACCACGATGGTCGTATAAAAGTTGGCGAGTCGGCTGAACTGCATCTTGAGGAACACGAACAGGAAGTTGTAGTACGTGTACTTGCTCGTAACGATGA
GGTTGGAGGAGAAGACAGGCGCCTCTTCCTGGGCTTCTGCCTCCTTCCTGCGCTGCTTCTTGGTCTTCAACGCGTCGGGCAACGTCATCGACACACCCGA
CTGACTGCGTCGCAACCTGTTGTTGGGGATGCCCGGGCCCACCACAATCTTCCGTCTGGCTGACGGACCTTCATCCTCGTCCATCTCATGGGTCGACGGG
TTGATGGACAGCGTCTGATGCAGCGAGTTGGCCCGCAGCGGGGACGGCATCATCGTGGCGAGAGCTGCGCGGTCGCACTCTCGCTGGTTCTGCACGGCCT
TGACGATGCGGCGGAGTTTCCAGCCGTACATGAAACCCGTGATGTTGAGCATGGTGAGCAAGATGGAGAAGAAGCCCTGCATAAGCACGGACGTGCCGCT
GCTGACACTATTGAGCTTGCCATTGTAGCCCTTGTAGTACCAGATGACGTCCACCAACAGCGTGAGTTGCATGCCGATCTTGTAGCTGAGCAGGAACTTG
GGCACGAGGAACTTGGTGCCATGCCAGCCCAGCACGAGCGTCACGTACAGGATGAGCACGGGCACCGTGGCCTGAAAGCTCAGGCCCAAGATAATGGGGA
AAATACGCAGCGAGTTGATGACCGTCTGCGACACGATCGTGAACTTGAGGCGGCGCCGCGTCTGGTAGATTGTCATGCCCTTGAGGAAGCAGAAAACCTT
CTCGAAGAGGTTCCACACCTTGGTCTCGGCGTTGGGCTTGGAATCAGACGCCACCGAGTCCGCCATACTGTCAAATGTCAACAACAAAAAAGGCGTCAGA
AATGATTAGTTCACGTGTCAAAATTGTCTTTTTTTCCATTTTCCCGTCGAACAAGTCGATGTGCTTGTTTTTAGGGACGAAGGGTGTTGTGGGATTAAGC
ACGGTACCTATCGGCACGATACCGCAGCGAGATGATGTTGCGCTGCTCCTCCTCGTTCGGGACGCCCGTGAACGTGTTGATGCGCCGCAAATTCTTGTGG
GCGTGTGACTGCGACGTCGGCGGCGGCTGCGCGCCGTCAGCGGAGGAAGGTGCTGTCTGGCCCATGTCCAGCGTGTACTCTGTGGAGCTGTCGGACGGCG
AGGGCACCGCGAACTCGACGCGCATCTTCAGTCCGTTGCGAAGCCGCTTGGAGCCTATTCTTGAGCCGC