Description :
From Genome Similarity Track
Location :
Scaffold_470:12680- 15556
Transcript NameFunction/comments
Phypl_g8634hypothetical protein
Phypl_g8635hypothetical protein

Sequence
2876 bases(100 bases per row)
cctcaGGCTCGAGCGGTGCGTCCCAACTGTCGTCTACGGTGGGCGTCGCGACGGCTGCTGTGGTCGCCATTGGCTCGTACTTCCTATGAGTCGACTGCAG
CTATGACAGACGCTCTGCAGCGTACTCGGTCAGAAGACACGCCCCCAGCCTTTCCAAGTCTCTCTGTAGCATAACATACATAGTACACTCGTCTTCATTC
ACCTTACTTTCCCATCATAAATCTACTCAATGCCAGTTTAGTCATTCAGTCAGACGAGAACTCTCGCCGGTTGGTAGCTGTCGTCTATGATTTTTGCGGG
AGGTCGTGTAGCGGAGATAGTGTCGGTGAGATGTGTTGGTTGGGGGTTGGACGGTGGTGGAGTCGGTGGATGTTGTTGATGTGTAAGTGGATCGAGGTCA
GTAGACTAGGACTAATTAAAATGAAGAAAAAAGGTGGGCCATTAACTTCTCATAGAGTGAAAGAGCTCCGTTCTCGGAGTGCTAGATCACTGTACAATTT
ATCCGTGTGCAGGTATGTTGGTACCTGGCGTGATAAGCCGTGTGATCTTTACGTTGCTGGGACCTTTCAATGGTGTCATTTCAACTTTTACGCTTCTGTG
ATTGCCTAGCGGGCGTACGACGCTGTCACGACCCCAGAAAACTTATCGTAGCGAATTCATACTCCGTATCCTACTCTACGCTATCACTGTCCGTTTCAAA
TAAATAGCGAAGGTTCTCTGCAGTCCCTCATCGCGCTCTATTCCAGATGTCGTttgtcgttcagcagcgacaatgATCCAAACATGCATGCTGTCGCGAC
GGACAGCTTGACCGACGATCGAGTCAGCATCTACAACATGAGAGAGCGACTCGAGTTCATGCTTGGAGAGGAATAGCAGCGTCACTACCACCAACGAAGT
TGGACGGTATGCGTCATGACCACGCTGATGCTGTACGGAGGGACAGTGACGCCTGGCAGCTGACGTAAATTTGTCGGTGCGAGTGGCTGAAAACGTCCCG
AGACAACCATGCAGTATTCACCTTCACAAACCTTTGAAATGAGCACGGCGATGACCCCCCTCCCCTTGTGATGTGTCATTATCTCCATTATCTGTGTCCA
CCCTCGAGAAAGATGGCGCTTCACTTTAACAGCCAATACTTCTCCGTCACGATGAACTTTGGAATTATTAGGCTCAGGTAACACCACGAAAATATGGCCA
CACGATCATTTAAACATCCATTCACCACAGCAAGCACTTGATCGATAAATTGGCGGCCAGTCAGACTTGTATACCTTGGGGGTGTTCGTGAGGACGAACC
AAGCACCGGACACGCCGTGAAAGCCAGACGACAAGCAAGCAACACAGTCTGAGAAAATGCTGCAAGGAATCCACACGATaacagcgccgacgtctCCAAA
CGGACAAGGGCGAACCTTTGTTGCAAGCGTCGTGACTGCATCCAGAACTCAAAAGAGCCCTAACACAGTCGAACGGCAACCCTTTCGAAGAACGCGGCAC
CATCACCACGTAGAGCTCTTCACAGCAGCTCctctgctcctccagcacccATTGCACTGAACTTGCACCAGTCGCCAGCCATTCCATTGTGCTCCCCGAT
GCTTGGCAAATACTTGGCAGGAACTTGCAACGGCTCGACGAACAGACCTCAAAAGacgccactgcagcacaTGACACCCCCGAACCAAAGCCAACCGACG
TAGAGCTAAGCAGAGAACGGGACTGGAACACTGTGCACCAATGTCCTGACACACTCCAAGCAGCAAAACGAGGTAACAAGAGGCCCTGGAGCAAGAGTAA
ACCAAAATATAGACAAAGTCCACAACAGAGCGATTGGCACTCTATATACACAGCCATCGAGTCCTGTACACACCACTGAAACCCCACCATTTCTTCCTCC
TTTTGTCACTAAACTCCTCGTTGTCTCCCGAGCGTGAGGAGAAGAAAGGGGTCAGCAAACAACATGCAACACACTCGGACGAGGTTCACCCCCTAATTGA
GAAGCTCCAACTCCCTAATTGAAGAGAATCCCTAAAAATAGGGTCCTCCTCACTCTTGTCTAGGGTTACAGGCAGCCCATTAGACTGCCTTCAATAGACC
GCAGTGAATACATAAATCAAGTCATGTGTAAAGTGCCACTCGCCAATGTAAACAATGTAAACAAATCGGTAAACTCTGCTCCAGGCGTCTCCACCGCCCG
TCGCCTTGCTACGAGGAGGCTCCGGCCCCCCTCCCCACTCCACACCGACAGCCACAAGACCCAGAAGACGCACACACGCCACTGCAGCGTCCCTGTAATC
TGTCCACGACCCCCGAAGCCCCCGCACGCACCCTGTCGCTCGCTCTAAAGTCTCCATCATCAGCCGCCAATACAAGTTTTGGAACTTGTTTGAAAAGCTG
TCGTGGTTAAGTACGATCTATAGGGATAATGCGCGACTAAGTACGGCTGCCTGCACTTCACGCATCCGCTCGTGGGCTCAATCGCGATTCGCGAGGCGGT
GggaagctggaggtggtcCAGGAATTGCAGCGAtgctctccagctgcgccgccaaGTGCCAGCTCGGGTTGCACGGACTTGGTGCTTGAATGTAGCCATA
TCGATTTGAACCACTccagttgaagtgctcgtcACCTTACGAGTCGTAAGTCACGACcgcgtcttcctccagcaggtccaaGACACCGAGGTCTTCCGGC
TCCTTGACGGGgtcggcagcgtcagcattGGGCTCGAGCGATGCGTCGTAGCTGTCTACGGTGGGCATCACGACGGCTGCAATAGGCTCGTACTTCCTAG
GAGTCGACGTGCAGACGCACGCGGCCAGAAGGCACGCTCGCAACCTTGCCAAGTCTGGATCTGCAGCATAACCTAC