Description :
From Genome Similarity Track
Location :
Scaffold_66:1268- 4571
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_66-snap-gene-0.16P-type ATPase (P-ATPase) Superfamily

Sequence
3303 bases(100 bases per row)
AGATGCAGCTCCGCAGGTGGAGCCGCGCGTGGCGCACGTGAACGATGCCGCGCGCAACCAGGAGCTCATCGCGACCCAGCACTACGCGAAGAACGTGATC
GTCACGTCCAAGTACACAGCCGTGAGCTTTGTGCCCAAGACCATGTTCGAGTTCTTTCGCGTGGTCGCAAACGTCTATTTCCTAGTCATCTCCCTGCTGC
AGGTTTGTGTGTTAGGTTCGGTTGGGCTCGCCCTTGCTGGTTAGCTTACAGATTGTCAGACTAAAGCCTGCTTGTTGTCGTATGATTTCTGTGCGTGTAG
CTTTTCACGACGTGGTCACCCACGAATCGCTTTACGACCGCGGGACCGCTGGCATTCGTGCTCATGGTCACGATGATCAAGCAAGGCTCGGAGGATGTCA
AGCGCCACCAAGCGGACGAGCACCAGAACAACCGCAAGTGCCGCGTAAGACACTCTCATGGTCGTAGTCTGAACGTCACAATGAACCTAGGTATCAAAGT
CTAACTCATGCCATGGCTGTCCAAATATCAGATCGTGAACGACCGAGGCGAGACCGAGACAATCTCCTGGCAGGAGCTCCAGGTCGGCCAGATCCTCTGC
GTGCGCAATAACGAGGAGCTCCCGGCGGACATCCTAATCCTCGCAACCTCGGAAGAGGAAGGACGGTGCTTCATCGAGACGTGCAACCTCGACGGCGAGA
CCAACCTGAAGCGCCGCGCCGCTGTGAAAACCACTGCCAAGATTGCTGGTTGGCGCGAACTCAACGAGCTGGTCCTAGAAGAGCAGCCTGTCTGCGCCGG
TGTCCTAAAGCTCAAAGGCACGCTAGAGTACGAGCAGCCCAACAACCAGCTCTACACGTTCACCGGCCGCATCTTGCTGGACAATGACGGCTCTGTCACG
CCGCTTGGCCCCGAGAACATCATGCTGCGCGGTTGTGGACTGCGCAGCTGCAACTTTGTGCTGGGATTCGTCATTTTCACTGGCGCTGAGACGAAGTTGC
TGCAGAACTCGCGGTCCGCGCCGTCCAAGCAGAGCAAGCTCTATAAGACCGTGAACCGGTGCATGGGACTCATCTTCGTGACCATGTTCTCGCTCTGCAC
CATCAGCGCGATCGTCGCCGCATCCTGGGACAGCCATAACGACAGCCGCGTGTGGTACCTGCCGTTCGTGACGTCCAACAACTTTGGAGACTTTGCGACC
AACTTCTTCACATTCCTGATCCTGTTCAACAACCTCGTGCCGATCTCGCTCTACGTCTCGCTCGACATCATCAAGGTGATCCAGGCCAAGAACATCACGG
CCGACAACGACATGATGCACGAGAGCTTCCGCGCGATCGCGCGCACCTCGGAGTTGAATGAAGAACTGGGCCAGGTCGAGTACATCTTCAGCGACAAGAC
CGGTACGCTCACGTGCAACGTCATGGAGTTCCGGAAATGCTCGATCGGCGGCAACTCGTACGGGTTCGGCACGACCGAGATCGGCCGCGCGGTCGCAGCG
ATGCAACTGTCGTCAGCAGTAGCACACAGTAACACTGTCGGTGGTAGCGGGAAGCAGTCGTCCGCAACCACCACCGAAGTCGGGGTCTCGCTGAGTCTCG
AGAGCTCGGCAGCCGACACCCGAGAGCGATGCTCGACTCCAGGGGCGCCAATGCTCGATATGAGCTCGATCTCTAGCGCGCTGAGTAGTCTCAGCAACAA
CAACAATCCGCAGAACGATCCGAAGAAAGCTCAGGTGCACTACGACCCGACGATCAACTTTGACGACCCAAATTTGCTCAAGCACCTGAGCACCGGCGGC
AAGCAAGCCGCGCTCATCCACGAGTTCCTCACGCTGCTCGCGATCTGCCACACCGTGATCCCCGAAGTGGACAAGACGACCGGGGTTGTGGCGTACCGCG
CATCGTCTCCTGACGAAGAAGCACTCGTGAAGGCCGCCAAGTGCCTCGGGTATAACTTTATCGACCCGGCGCCGCTGACGAAGATCGAAATCACGCGCAA
GAACCTGGACTCGGGCAAACCCGAGCCAAACATGCCGATCAAGCAGTCGTTCACGATCCTGAACGTGAACGAGTTCAACTCGACGCGTAAACGCATGTCG
GTCATCGCCGTGAACGACAAGGACGAGTACGTGCTCTACTGCAAGGGAGCGGACAACATGATGCTCACGCGCTCGGTTGAGGACGAGCACACGGCCGCGA
TCAACAACCACCTGCGCGTGTTCGCAAACGAAGGACTGCGCACGCTCGTGCTCGCGAGACGCGTGCTCTCTCGTGAAGAGTACCTGGCCTTCAATGACAA
ATACATCGAGGCATCGACATCACTGCAAAACCGAGAGGAGAAGCTTGACGCAGTCGCGGAGCTGATCGAGAAGGACATGCAGGTCCTAGGCGTGACGGCG
ATCGAGGACAAGCTCCAGGAGTCCGTGCCTGCGACGATCTTCGACTTAGCGCAGGCCGGGATCAAGATCTGGGTGCTCACGGGCGACCGCGAGGAGACCG
CGATCAACATCGGCCACGCGTGCCGACTCATCAACGACAACATAAAGTTGTTGTACGTGAACCAAGAAGATATCCAGGACCTCGAGAAGCAGATCGACGA
GCTTCACAGCGCGCCGTTCATCCAGCGGCTCGTCCGTGAGAAGAAGGTCTCAGAGGAGATTGCGATGGTTTGCGACGGCAAGGCGCTCGTGCATGTGTTC
CCGTCCAAGGACGCGCTCGCGAACATGAGTGACGAGGTGGCGCAGCGCTCGAAAGTGCTGGCCACTAAGCTGCTCGCTGTCGCGAGCGTCTGCAAGGCGC
TCATCGCGTGCCGCGTGAGTCCATCCCAGAAAGCCGAGATCGTGAGCCTCGTGCGCAACGGCTCGCCGAACAAACCGATCACGCTCGCGATCGGCGACGG
CGCGAACGACGTGAGCATGATCCAGACGGCGCACGTGGGCGTGGGCATCTCAGGCAAAGAGGGTGTCCAGGCAGTGAACGCGAGTGACTACGCGATCGCG
CAGTTCAAGTTCCTCAAGCGACTGGTGCTCATCCACGGCCGCTTCAACTACAAGCGCATCTGCAAGGTGATCAAGTATTCGTTTTACAAGAACATCGCGC
TCGTGATCAGCCTGTTCCTGTTCAACTTCTACAACGGACAGTCCGGTGCGCCGCTCTTCGAGAGCTTCGTCATGGCCGGCTGGAACTTCTTCCTCGCCAC
GCCGATCATCGTCATCGGCGTGTTCGACCAGGATATGCCCGAAGGCGTCGTGCTACGGTTCCCAAAGCTCTACCGCGCGGGTCAGCGGGATAGCGACCTG
AAC