Description :
From Genome Similarity Track
Location :
Scaffold_75:1268- 27013
Transcript NameFunction/comments
Sapdi_VS20SDRG_14585hypothetical protein
Sapdi_VS20SDRG_14586hypothetical protein
Sapdi_VS20SDRG_14587hypothetical protein
Sapdi_VS20SDRG_14588hypothetical protein
Sapdi_VS20SDRG_14589hypothetical protein
Sapdi_VS20SDRG_14590hypothetical protein
Sapdi_VS20SDRG_14591hypothetical protein
Sapdi_VS20SDRG_14592hypothetical protein
Sapdi_VS20SDRG_14593hypothetical protein

Sequence
25745 bases(100 bases per row)
TCCACACAAAACCATGGTCCTGTGTTTGCGCAATCGCAGGCCACATGACCCATGCGCTTACGTAATCACAAAATGGCTCTGCTGGTACGGATTGGGCGCC
CGTGCAAATCGCTAAATCCAAGGATTCCAGCATCGAGTTTCAACGGGTATCCGTAGACGCTTTAATTCTGACAGGTTTTTTTCTACGGGTACCGGTACAG
ATGGGCTCCGAAATCTCTCTAGTGTTAATAAAAAAGCGATTGGGTTAGATTTCAACTAGTTATCGGACGCGACTTAGACAATTTTGGTCTCAAACTTGAA
CGACCAGCGCTGGTTGCTCTGGTTCTTGTCGCACGGCTGGAGGCTAATGCCGGCGCTGTCGCCCGCGCTGCCCGTGGCCGCGAGACAGAAGCCGAGGTGG
CCCGTGTGAAACCACTGGCCCGTCACGTCGTTGTAGAGCCACTTTTGGTTGACGTTGCTGTCGTCGCACGCGTACGTGTGGACGGCGTACCCGTTGTCCT
TGCCGTACGCATCCAGACACGTCTTGCCCGACTTGGACGTGATGGTTTGCGGCACCGGGTCGTAGTACCACGCTGCGTTGTCGCTGTACGTCGCCGACAT
GCTCGGGTTCCACGAGACGCCGCCGTACCACTCGTTGAGGTACCCGTTGCCGTTGACTTGGATCTGCATCGGCTCGTCCTTGACGTCGCGCTTGGTGAAC
TTTTGGTTGGGCCCGTCGTAGCACCACCACATGCCCACCTTGTTGTTCTGCGTCGGGTCGACGTCCATGCACTGGTTGGCGCCGTTGAGGCTCTGGAGGT
GACCGTCCGACGTAAACTGCCAGTTCTGGTTGGCGTTGCCGGCCGTGCAGCCGTAGACGTGCACGTTGAGCGGGTTGTTGCTACCGCCGTATGCGTCCAA
GCACTGGTGCGACGCCTTGGAGTAGTACGCTTGCGAGTCGGGGTAGTAGAACCAGATCTCATTGTCGAGGTTCGAGGCCGGACCTTGCGCCGGCGCCTCG
ACGAGCAGCGCGTTCCAGTTGGTCGGGTCGACCTTGAGCACCGCATTGTCGCCGTGGTAGATGCGCGTCGCGATCGGCTTGCTCCCGACGGTGATGGCCT
GCACCGGGCCCTTGAGGTTGATGTTCTTGTCAAAGATACCGAACGACTGCTCGATCAAGTCGCCGGGGATCGCGAGGTCGATGGCCGAAAAGTAGTAGTA
GTTGAGGCCGTGCTTCTCCGCAAACGCGAGAAAGTCCTTCGTGTACACACCCTGCGCTTGCGGCGAGGCCTCGACGACGAGGTTCTTGTCGTCCGCCGTG
CTCCAGCCCGTCTCCGAGATGATGATCGGCTTGCCCTGCGCGCGCGCCTGCTTCTGGACGTCGCCCCAGTGCCACCACAGCGTCTCGACGCCTTCGGCTG
CCGTCTTGTTTTCCCAGAGCGAAAACTGGTTCACCGACACGACGTCGACGGCCGAGTAGATGGCCGGGAAGAGGTTATATGCGTCCATGACATCGGCGAT
CGTGACGGGGAAGAGGATGCCCTTGCTGCGGAGGTACGAGCGCACGTTGGTCAAGTGGTCGACGAGGAGGTTGTAGCCCGTAAGGTCCGTCGCCGGGCGC
TTGCCCTGGATGTAGTAGCGGTACAAGGCCTCGCTCGCGACTTGGACGCCGGCCACGTTGTCGTTGCGCACTTGGTTCGACTCGACGAGCTGCTTGAGGT
TCTTGAACTCGCTCGCAAACGCGTCCGAGACGCCGGACGCCGGGACGTCCGACCAGAGACCGATCCAGATCTTGAGGCCGGCGTCCTTGGCTGCGGTGAG
GATCTTGCCCGTGCACGCCGTCGAGTAGATGCGCACTTGGCTCGTCGTCTTCTTGAAGGCCGCAAACTCGGCCGCGACCTCGTGCGCGTACTTGCAGCCG
TCCTTGTCATAGCCGCGCGTGTCGTAGTTGAGACCGTCAAACTTGCGGTCGAGGGCCGCGGTGGGCGCGGCGAGGAGGGCCACGGCCGTAGCGAGGGCGA
GGGACGGGACCTTCATGGCGACTGCTGCTGCTGCTGCTCAAGCAAGTTGGGTTGTGCGTGCTGAGGGCCGTCGCTGCGTCGGGTGTTGTAATCGCGACCG
GCTCTGTAACACTCGGTCGCACCAATGGCCTTTCACTGTCTCCACCTCGCCAGCCAATGAAAACGCGGGCTCCTTCCCGAAGTTCGAAGATCGAACGCGA
CCAGAAGGTGCCTCAAAACCAAGTGCAATCTCGGTAACGCGCCCGAGCTTCTACTTTGGAAGCGGCCACCCGAGGCGGACCCAAGTGCAGAAAGAACTCC
ATCGTCCTCAGCAGTCACGTAGTAAGTACACTGTACATCCCTAAACACTGCGTTCTTATAATGTTCTTCGTAGTCTTTAAACGGCCCGAGATTCCTGTCG
ACAGAAGGCGACGATGCCAGTACCGTTGGCGCCATTCCCGGATCCGCCCTCCCGCAACGTCCGCATCGCTGCAACGTGCGCGAATCTCTGCACGCGGCGC
CAAAAGATATTGCGCCGTGTCGCATGCGTTCGATCGTGCCGACGATCGGGCGTGGCAAGCCGTCGTCGACACTGTCGTCGACTGGCAAGAACCCGTGGCG
TCAGCTAGTAGGTGCGTCGCGGCCCCAGAGTGGACCGTACGTGGCATGGTCGTAAGAGCGTCGTCGGTAGAGGACCGAAGGCCCGTCCTTGCAGTACAGC
GATCAGACGTGGCAAGGCTGCAACGCATTGTGGAGACTGATAGGCGCGTGACCAACGACCGCCACTGTTGGGCGACAGCGTGCGGCTGCAAAAACCAAGC
ATAACGCTAGTTAACACTGCGTGGAGTACCGGTAGTAATACTGCATCACAATATGGATACAAAGAGTACAGCCAAGGTTACGAGCGTGAGTTGGTTTAGT
TGGTGGCGAAGGCCATTGGCCACTTGTGTGACGCCTTGGTCTTGTCGCAGTAGTCGAGGTGCGTCTTGCCGTTTGCGAGCGTGTCGAGACAGAGACCGAG
CTTGGACGCATGCATCCACTGGCCAGTCACGTCGTTGTGCTGCCACTTTTGGTTGGCGTTGGCGTTGTCGCAGTCGTACACGTGGACGGCGACGTCGTTC
TCGGTCTGGTAGCCGTCGAGGCACTTGCCCGAGCTCTTGGACTTGAGCGTCTGGTGGAGCGGGTCGTAGAACCAGACTGCGTTGTCCTTGTACTTGACGT
CCGAGGTCGCGACCACGTCGCCGTACCATTCGTAGAGGTACGTGTTGCTCTTCCCGAGCGTGATGGCCTCGGCCGCGACCGGGCGCGCCGCAAACTTTTG
GTTCGGACCGTCGTAGCACCACCACATGGCCACCTTGTCGTCCTGACTCGGGTCGACGTCCATGCACTGGTTGGCGCCGTTGAGGTTCGTGAGATGGCCA
TCGTCCGACATCTTCCACTTCTGGTTGGCGTTCTCGGCCGAGCACGCGTACACGTGCACGCTGAGCGCGTTGTTGCTATCGCCGTACGCGTCCAAGCACT
GGTTGGAGCTCTTGGAGTAGTACGTCTGCGAGTCGGGCTGGTAGAACCAGAGCTCGTTGTCGAGGTTCTTGCCGAGACCGGACGCTGGCGCTTCCACGAG
AAGCGCGTTCCAGTTGGCCGGGTCGACCTTGAGCACCTTGTCGCCGTGGAAGAGGCGCGTCGCGATCGGCTTGCTCCCGACGTGGACGTTGGCAATGTCG
GGCTTCATGTTGGCGTTGCCGTCAAACATGCCAAACGTCTTCTCGACGAGGTCGGCGTCGTGGACAAGGTCGATGGCCGAAAAGTAGTAGTAGTTGATGT
TCTGCTTCTCGGCAAACGAGAGAAAGTCCTTGGCGTAGCGCGCCTGGGCGTCCGGCGAGGCTTCGGCGACGAGGTCCTTGTCGTCGCCGGCGCTCCAGCC
CGTCTCGGAGATCATGACGGGCTTGCCGGCGGCTTTGGCCTGCTTGGTCACATCGCCCCAGTGCCCAAAGAGCGTGCTGACGCCGTCGACGGCCTTGACG
TTTTCCCACATGGAGAACTGGTTGACCGAGACGACGTCGACGGCTTCGTAGAGCTCCGGGAAGAGGTTGTATCCGTCCATGACGTCGGCGACCGTCACGG
GGATGTTGATCTTGTTTTCGCGCAAGTACGCCCGGACGCGCTTCATTTGCTCGATGAGCCAGTTGACGCCCGTCTTGTCGGCCTTGTCGTGCTTGCCCTG
GATGTACCAGCGGTAGAGCACCTCGCTGCCGATCTGGATGCCGGCGACGTTGTCGTTGCGGATCTTCTTGCTCTGCACGAGCTGCTTGAGGTTGTTGAAC
TCGCCGTCAAACGCGTGCGTGTACGTCAGATCGGACCAAAGACCGACCCAGACCTTCATGTTGTTCTTGGCTGCCGCATCGAGAACATCGGACGTGCACG
CCGTCGCGTACACGCGGATCGCGTCGGTCGTCGCCTTGAAGGCCGCGACTTCGCGCTGGATCTGCCACGGTTGCTTGCAGCCGCTGCCCGACGCCGGCTT
GACGTCGTAGTTGAGGCCGTAGAACTTGCGATCGAGCGCCGCGACATGGCCCGCGGCGAGCGCGAGAAGGAGCACAGAGGGTACTTTCATGCTGATGTGG
TTGTGTCGGAGACGGAAAGTTGTGGAATGAGCTTTTACAGCGGTTGCAATCGCGCGGTTGCAGTGACTCACGCGCCACCGGGTCAGGTGTGGGTGTTGGA
AAAAATGACAATGTTTTCCGGTAGGATGCAAGGCCGGATCGAAGCCTGGTTTTGAAGAGAATAGACTCTTCTAGGATACAATTAGGACTAGGACAATTCC
GATCGGAAAATGCTTGGTATGTGCAACGTAGTTCGAAGCTGTAGACCACAGCTTGAGCACACGGTTTGTATGCACAATCGAAGTTAAAATAGACAAAGGC
GACCAGGTGCAACGGATCTCTGAGGTTACACGCTGATGTTTGCGACACGACGGCAAGCTTTGGCGTTGGCGCACGCCACGCCGCTGCACCGACGACGCTG
CATCCATGCGTGAGTGCGAAAGCGGCAAGATGAACCCGACGAAAGGGTACGAGTCGCCCGCATCAGCCTGCCCCAGCGACGGCGGCTGCCACGGGCTTGC
CGCTCGTTGTAATAGATCGAGTCCATCGAACAGCAAACGCCTTTCGCAGGCGGAGGTGGTCAACGACGACGATTCAGAGGCGACTGTACATCGTACTCGA
ATTTTGACCAAGACATTCAGTAGCCGCAATATTCCAGCGTTGCGTCATCCAAATATGCAGCCATACAGAGCCACGACGACGGGTACGAGCGGTCGTGGCT
ACATCGTGTTACCTCGGCCGATACTAACTGTAGCAAGCGCGCACGCCTCTACGTGGGCGAAACACACGACCAGCGCAATTGGTGATGCATTGGATTGAAT
AGAGTGCTGAAGGGAAGAAGTCATGGTCGATCGATTCAAAATCGTGGCATGCGGAGGACGCAGCGTTATCGCGTGACGCACGCAGCGGTTTCAGCTCCGT
GTCACCGGCGATGATGTAACCGCCAGAGCCAAAACAAAGCTCCTGCGACCTACAATATGGTCCAAGACCAGGAATCTGACATACCAACAACTCGGTGGCT
CATGCTATTCATTATGTCCTGATCATAGCGTACTAGGACGTGAATCGATGCTTGTTGGTAGGCAAACGCGCCGTCGCTGCTGCTAATCACAGCTCTACTC
GGCTGGATGGCCTCCTAGTACAGTTCCAGACTGCACTGTGCGCGAGCTTTGGTGATGCAGTGAGGGCTCCCATGACGTTGCGCAACCTCAAACGAGTGTG
CGGGATGTTCGAATACCATTGCAGTGATGCACTGTGTCATCGTGACGTAAGGTACATCGCCATGCGCGAAATGCCTCTCCATTTAAGTTTCCTCTTGTTG
GTCGCCTTGCCGGGTTCGCGCGCTTTTGCAATACAAAGAACGAGTGCATTGCTTCACGTCTAGCACACGTTCCACGTTCCTGCGAGCCCACCCCATGGGG
CGGGACCTGCCAAAGTTGTGTATATATTGGTATGAACTGCCTCGTACATGAAGCGCAATTGTATACCTACTGTGATCAACCCTTGGATGAAAGCGCACAC
TAAGAATTTTAGTGCGTAGTCGGCGGGGCTCAGATCTTAGTCTAAGATCAGAGCCCCGCCGACTGCTGGACTATCATGTACGTTACTAGTACTCTTTACC
GGAGGTAGTTTGCAAAGGAGGCAGAAGCCAAACGCAGGGGTTGGGTTTGCGTTCTTTTGCTGGTTGTCGTTACTCTTGCAACAACGGTGTCGTTCAAAAG
ATCGCGCCATTTCGGGCAAGTTCCGTTGCTGGCTTGGCGCAAAGCGATGTGATTGGCTTCGAGAGCCGGATACGATCGCCACATTATCCAATCCGGGTCC
GTGTCCGGATACGGAAGCTTTCGAAAGTTGCTGCAAAGAGGATCGCAACTGCCTCACGGGCACGCATGCTCTGCGACGACTGCAAGAAGAACAGCGTCAC
GGTGTTCCGGCCAAAAGCCGGCGGCCTTGCATTGTGCGCCAACTGCCGCAAGCGCCGCAAGGCGGAGGGCACCACCGCTTCAGCTGCCGCCGGCGCCCGG
CCCGCGGTTGCAGGCCCAGCCTCGGTGGCCCCGCTGCCACTGACGTTGATTGCTGCACCCGTGACGTTTGTCGCTATTGCACCCACAACCTTGGCTTCGG
CGCCGTCGCTGACGTCAATGAACGCGTCAACGAAATCGCCCATGGATTCGGATGCCGTCGCGCCGCACCCGCCGATGTCGAGCGATATTGAGATGCTGCT
GGCCGAGATCTATCGGCTCCGAACCGTCGAACGCTTGCAGCACAAGCAAGTGTGCAACCAACACGAGCAGGTGCTGGCGCTGGGCAAAGCTGCTGCCCAC
CAGAAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCGAAGTTGCGCTCTACGACCGCTGCGACAGCGTACCACTGAGTGAGATCCAAGGGAACAACCAAGTTTTCTTCCCTTGGTGAGGTCGTTGCC
TGCCAGCTCTGGCGCCTGCTGGGCCACGTGTTCGTCAGAGACGTCCTGGCCAACATGGCTGCTGACCGCTTCTTCGCCACGTCCGCCCGTTTTTAGGGCG
CGCCAAGATCATGCCGCCGATCTCCTGCACTGCGACCTTCAGTCGCTGACTTCGCCTCAGTCGCTGGCATCTCTCGAGGACCTTGAGAAAAAATGCTCGG
CTTTGCCGCCGATCGCGAAGACTGGAAGGACAAAGCTTGTCGTCATGGGCCTCACCCGCGGCCGCAAGCGTCCTCGAACGACGACAGAAGAGCAAGATGA
GCCCCCGCGCCGCCGCCTGACCTCCGCAGCCACGGCCTTGAGCGAATGACGAAGAAGGAGATGGCTAGTCTCTACGTATGCCAAGTCTATGTAACAACAA
AGATAACGCGAAACACTTTGCGCAGCCTTGACGTCCCTTTGAAATAGGAGGTACAATTAGATGACAAAGAGAGACCCTTGAAAAGCCCGAGCTACCCTTC
AGTTGCCTCGGACGGGCGATAGCGCAGATGTGCGACTCCAGCCGAGAGATCGTCGCTTGCGGCTCTATAATCGTGCTCATGGCAGCAGCGCAGTACACCG
AAAGCAGCTGTGCGTGACGGCGCTGCATGTTGTCGACTTGCTTTATGCGGACTTGCACTTTGGCTGCGAGCGTCGCTTTAGAGGCTGTGAGATCGACTGC
GATCACCGCGTTTTCCTTGCGCAGCTGGAAAGCGATGGCTTGTTGCACAGTCGAGTCGCGTTGCAGCAGGGAGATAGCTTGCTTCTGGTGGGCAGCAGCT
TTGCCCAGCGCCAGCACCTGCTCATGTTGGTTGCATCCATCGGCCAGCAGCATCTCAATTTCGTCACACGTGCGGTGGTCCACCGAGGCGTCGTGCTGGT
CTTTCTCGACATCTTTCTTTTCGGCCGCACTGCTGCCGCTGGTAGCCCCTAAGCTCGCGCCGCGATGTCTGTGGCTACATCTTGAGCAATATATGCTGAC
AGTCGTATCGCCCCGCGTATGGCGGCGCGGCCCACGCCAAGGTGCGTCCATCTCGGTGCGCGGCAGACGGGGATGGTGAAGACCTTCCGGTACTTGTGCG
GGCCTAATCGGTTGTTGTCCGAGTCCGTACGCCGCGTGGTCACGATGCCGCCGCTGTCACCACCAAATGCACCGAGTTGGCGTCGGTGGTAGCCGTGGTC
ACTCACTTTCCTCCTTTTGGCGTCGAGCCTTTTTTAGCTCGACAAGGTCCAGCATCAAGTTATTGTCGTCGTCCGACTCGGTGGTGCTGCTGCCGTTCAC
CGCCGCGTCCTTGCCGTCGTCGTGCGAGTCGCTCGCTGCGATGTCTACAACATCCACGCACTCCATGGCGGCCGCGTCCACGGCGCCGCTCGTGTCGTAG
TAAAGAACCGCGAGGCCGTCGCCCGACACCACCACGCTGCACAGACGCCCGTCCTTTCGCCCTACACGAGCGCCGCTCCGTGTTTTTATACACTGGACGA
CGACAAAGGTGTGTCGGGTGTAGAAACCCTAGCCCTTTCGTTCGGTGCAGGTTTCGCCAGTGTGACGGGCCTGCCGTCCGTGGCGCGGGAGAGCCGAATG
GGTGCGGCGCGACGTCGAGGTACCTGGCGACACACGCTGCCACCGACGCGCGCGCTGGCCGCCGACAAGGCCAGCGTAAACGTGCGTTTGGGTGCACCGT
CAAGGACGATGCAAGGAACGAACTTGACCTTCCGCGGCGCCGCCGGAGGCTAGTGACAAACGCCATGAACGTCACCGTAGTGGCATGCTGCACCTCATGA
ACGCGCTGCCCAAGACGAAGCAGCCGCTGCGCCCGGGCTCGCGCTTGAGATAACGACACGATCGGTTGCGCGCCCGCCTCCGCAAGCGGTACACACTCCT
GAGAGCGGCAGCTAACGGACGAACAATTGCTAAAGTATGTTCTGCAGGCTGTAGACTACGCGAATGGTCGACAGTCGTGCGCGCTGCTGAGCGTGGCGGA
CAGCGACGCCATGCTCCTGAGGTCAAACTGCCATGAAATACGATCGGATGTTACGATGTTACGAAAGCATAAAGCGCTCACTTGGGCACCTTGGTGATGG
TGTACTGCGCGGACCAGTCGCCCACGGGCTCCTTGACGAACGCCGTATACGGGAAATAGGGATTCGTCGAGGCGCAGTTGTTGCACACGCCGATGAACTT
GGAGCTGGCACTGTTGCGCAGCGCCACGCGACCGTTGCCAGCGTCCATGCACGTCCACTGCGCATCCTTCGTGCTCGACCAGTCCGAGATGTAGGCGAAG
GCCGAGTCGAGGCCGTCGTTCTTGTGGCAGTTGAAGCAGCGCGCGAGGTACATGCCGTTCTCAGACTTGAAGGCAAAGTCACCGGCGACGTCCGTGTGCA
CCACGGTCCAAACGGACTTGGGGTTGGGCGTCGTCGTGTCAAAGACGACGGCGCCGGGGTACTTGCTGTTGCGAATGCAGCCGTCGCAACGCGAGACGTA
GTTGTTACCCCAGGCCATCGTGATCGCGGTGCCGTTCGCCAGCTCGCAGGGACCCGCCGTCGGTGTGGGCGTCGGGGCGAGCGTCGGGGCAAGCGTCGGG
GCAAGCGTCGGGGCAAGCGTCGGGGCAAGCGTCGGGGCAAGCGTCGGGGCGGGCGTCGGTGTCTCGCCGCAGGCCGCAATGTCCGTGCCGGCGACGACCG
TGACGAGGACGGCAAGCGAGGTCAGAAGCGTAGACGACATGGCGCGTGGGAAATTGGAAAATGGGATTCAATATGTACATATCCAAGCATGGTCCGAAGA
GAGGGATCGGGTGCAATCACTTCACTATCAGTCGAGCTATCAGGCGTGCTGTGACAGCTTTCGGTACATAGTACAGAATGCTATCACAGTACAACTGATA
GCTATTACATTGTAATAGTGTTTCGCGACAATCCACCTACCGTGGATGTCACTCGTACAGCAGGGAGAGCTAGCAGGGAGAGCTAGCAGGGAGGTAAATC
GATTGTTGGAGTAGGCAGTAGTAATGCTGGTTGTGAGCCCAGGGACTTCACTTGGATGTACATGTAATAATAAGCTTATACACCAAGTATGCGTATGAAA
GCTGTGGATATTTGGGTGGGGAATATATAAGCCAAATATGGTGTCTTCGACAGCTCGAATACGGACTGATAGGAAGCAAACTCAGCGCTCGTTCGTTGTG
TGGTGATGCACAGCGCTCATTGCACGTCTAGCACGAGAAAAAGACCCGCCCATGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTGTCGATTCCGTCGCCACGCGCAACACCGA
CTGACGCCTCGGCGCTGACGCTGGCGTGGCACATCGCCGACAGATCGGTGACATTCCGCAACCCGTCGACCAAAGCAGACGAGACCAAGGCCATCTTACA
CGATGTCTCGGGAACGGCTGCGCCCGGGCAGTTTATCGCAATCATGGGCCCATCGGGCGCTGGCAAGAGCTCGCTTCTCGACGTCATATCCGGTCGTGTC
ACCAGCTTTCACGGCTCGGTCACGGTCAACGGCCAGCCATGGACACGCGGCGCACGTGCTACGTCATGCAAGACGACCTCTTCTACCACACGCTAACTGT
GAAGGAGCATTTGCTCTTTCAGGCCCAATTGCGCATGGACCCGGACGCAAACCATGCGGCGCGTGTCGCGGACGTGCTAGCGCTCATGGGCTTGAGCGAC
TGCCAAGACTGCTACATTGGCAACGCGGCGACCCGTGGCATCTCGGGTGGGGAGCGCAAACGTCTCTCGCTGGCGTCGGAGCTTCTCACCAACCCATCGA
TTCTGTTTGTGGACGAGCCAACGTCGGGTCTTGATAGCGTCACGGCCGAGTCGGTGGTCCAGGAGCTCCAGCAGCTTGCTGCACGTGGCCACACGGTGCT
CGCGACCATGCACCAGCCGTCGTCGCAGATCTTTCGCCGCTTCGACGCGCTCTACTTGCTCTCGCACGGCCAGCTCGTGTACGCGGGCCAAGCCGCTGCC
GCGGTCGACTACTTTGGCTCGATCGGCGTGCACTGCCCTGCGTATATGAACCCGGCCGACTTTTTCATGCAAGAAATCGCGCGCGTCGACCACTTGGCGC
ATCTCGTCGCGTCGTGGCGGGCGGTGGCGACGTCCGGTAGCCCAACCCCCACGAACATGACGGCGCTCGATGCCCCGAGCCGCCCTGCACCGCACCGTCG
CGCAGGACTGTACCAATGGTCGGTCTTGTGCCGGCGCAATCTCCGGCGCCTCGTGCGGGACACGGCTGCGTTCAAGGCCCGCCTCGCTCAGAGTGTCGTG
CTCGCCCTTCTCTCAGGTCTTATTTACCGCAATTTAAGCCTCTCTCAGACCGGCATCCAGAGCTTTGCGGGCGCGCTCTTCTTTATCACGCTCAACCAAG
GCATGCTCGCGGCCACGTCCGAGTTTGTGCAAATCCCGCTCGAGCTGCCGCTACTGCGCCGCGAAGTTAGCGCCGGCTTATACGCCCCTACAACGTGGTA
CTTGGCCAAGAACGTGAGCGAGCTCTGGACCCAAGTGCTCTTTCCTCTGCTCTTTGTCGTCCCCGTCTTCTTTCTCATTGGGTTTGACGCGCACGTCGAG
GAGCCGGCTTCCGTGTTGTGGACCATGTCCCTCTTTTTGTCGCTGGTCACGAGCGCGTGCGTCGGGTTAGGGTACGTGATCTCGTGCGCCGTGCCCCGGC
CCGACGTGGCGCCCATGGTCGGCATCGTCGCGCTCATGCCGCTCGTGCTCTTTGGCGGTCTCCTCGTGAACGCAAACGACACCCCGGGGTACTTTGTCTG
GCTTGAGTACCTCTCGCCCATTCAATATGGGTACCGTGGCTTGAACCGCGCGTTTTGGACCGCTGTGCCTCACATTCCGTGTGCCACGGGGCAGCGCTGC
GCTGCGCTCAGTGGCGCCGATGTACTGGAGAACGCAGCGCTCGATGGGCACTCGCTGCAGTACGATGTAGGGCTCTTGCTCGCCATCAACGTCGGCTTTC
GCTGCCTCGGCCTTCTCGCGCTACGACTTTCGTTGCGTAATCGAAGACACTAGATCCATTCACTGCAAAGTCAATGTACACTTTTCGCGTCACAATGGCG
GTATTGCCGTCCATCCAAGTGATTTATTGTTCGTCGGGAATAGCTAACACAAAGCCTTGGCTTGTGACTTTGTGGATACGCCTTCGAGCTCCCAGGCATT
CTGCGTCATGTCATTGAAGCGTCTCGCACCCGTCGACGCAAAGCTGGATGAGACGACGACGACCAGCCGTCCGCAGATGCAAGCGATGTTCTACCAGTGA
CATTGGCTCTTTCATACGGCTCAGGTGGCAACGCGCAGATGCCCAAGTACAAGCGGGTGTCGTTGTCGACAAAGAGGCTTCAAAGCACAAACATCAATGC
AGTACATGCGCTTAGAGCTCCTGTTGCTGCGTCGACGGCGGTCGGGGTGGCAACGATGGCTGCGCAAAGGCCGACGTCCGGTTGCCTTGGGTATCCACGC
CGCGGGTCTGCTGCTTGGCTTTGGCCGAGGCCTTTAACGAGTTGAACCATGCTTCGTACTTTTGGAGCAGCACGTCCTGCAACACTCTACCGTGAGATAG
AAGGCAAGAAACACAGCAAAACCTTTTCTTGGGCAGTGCGCTGCGCCGCATCCAGCTCGGCACGGAGTTCGGCGACGAGCGGTGAATCTTCAACGTCGCT
AGCCGTTGCATATATATGAGCGGCAACGTATGACGAGCCAAGTAGTCGTACATGTGCGACGGCTTGGCGTCTTGTCGCTGCTGCTGACGACGCCACTCTT
CCAGTGCGCGCTTGAGCACGACAAACTAGCCGAGGGGTTAGGGTGGACACCCTTTCTCATGAACTGCACCTTTTGGTTGTACTCGAGTTTGAACGTCTCC
ATGGTTTGCGTCAATCGCTTATTCTCGTCGGCCATTCCTTCAGTGCTCTGGACGTCCTATCGCCACATCCACATGGCAAAATGCGTCGACATCGAAGCGC
GCACCTGACGCAGCTTGGCGTTCTCCGTGCTGAGTGTCTTGACGGTGTGGGTGAGGCGTGCGATTTCGTGCTTGTGTGTCGCCAGTGCGGCCCGCAGATG
CTCCATGGCATCCGTCGACGGCGATGACGAGAGCCCGTCGTCCTATACACATGTGCTCGCATGGTCAATGCAGAGCGCGCAGCTAAGACTACGTCATGAT
GGGGCGGCTTCTCCGGCGACGGCATGATCTCTACAGTCGTCGTGACGATAGCGTGAAGAACTCGCAAGCGTCTACCGTCTTCTTTGATGGGGCTCGGGAT
CGAGAGGCGCGACGATGGTGCGGTTGAGAGCTGGCTCAAGTACCGTTCGCGGTGGTTCTTGTTGCGGTTCCCGATCGCGGCCTTGAGCGTCGTCTCGCCG
TCGACACGGGACACGAGGGGCATGCGCGCATTGCCCGTCGGCAAGAGGCAGAACGAGTCGCCGAGGTCCGAGCTCAGGTACTGCTTGGACGCAGGCCGCG
CCCCGGCGTTCGTAGCATACCCCGGAAGGCCAAGCGCTTTCAGGCGCTCAAAGAGGTCCTCCATCTCGGATGCTGCCTCGCGCATGGACGTGGCGCTGTG
CGGCGCGCTGGAGGATGGTGTCTCGCTCTTGGCCGAGGTCTGCGCCGGGACGAACGGCGCTGCTGTCGTCGTCGTCGTCGTGGACGGCGGTGGAAACGAC
GGGCGGGGCGTCGCGTCTGGCATCAGCGCCATCTGCCACCGCACAGCGCGCTGCTCGTGGTTCTCCGCAATAAGCTTGAGCGCAGCGCGCGTCTTGACGT
CATTGGCGGCAATGTCATCCAGGGCGCGAAGGTAGCATTGGCTCGCCAACTGCTCGAGCTGCTCGGCGCGGTCCAGCTACACACGCCATGAGATGCACTC
GTTATCGGCGAAGAAGCTACATGTCCAGAGGAAGCATACTCCTCGGCCTCGAGCGCATACTGATGGCCGAGGACGACGGCCGACCGCGACGTCGCTGCCC
GCTGCGGCCGGCCCGCGGTTGGTTTCATCAGCATCCTGCGAATTTCGACCCGAAGAAGCACGGTCGCGAATATAACATGATAGAGGTCTGGAAGCACTTG
ATATTTGCATGTCGAAGTGAATATGTTATTATAGAGGTTCTCCCGACCAAGATCAAACGTGGCAGCACCAGCGTGCGAGGACTTGATCAGTACTCGAGTT
CTGTTGCCGCAGTTGATTAAAACAGTGCACCGTGAAGTACACCGCGATACGTGCGCGTCTAGTACAGCTGCCGAGTGGGCTCGAGGAAGTTGGAGGCGGC
CCACAGGGTCGACCTTAATGTCCTTGTGTGGCGAGTTGCCACCAAGTACCGCGCGCATGTGACGGAAGCGACTACCGGGTAGGCACCAAGAACAACTACA
GGTCTATAGTCTACATGGTCCACATGTCTATAGAGCTGGTGTACGTTGAAGCTACAACCCTTCCCATCTACTCGGTCGACGCGATCGACGACGGCTCGAC
GACCATGTACCGAACATGGTCGTGCCCCATGTCCTGAGTACGGTGGGCGGTGAGGCGACTTGTGTCCAGTCGTCGAAATGCAAAATGACGCGCGTCCGCT
CGGAAAAGCCGTGTTTGGCGAAGAATGCGAAGCCCGCTTCGCTTGCATGGACCCACATCGGGAGATTGCCGCGAAGACCCCACGCGAGAAGCGCGCCGCC
GACGCCCGCGCGTTGTTGCGCCGGCGCAATCAAGCCAACTCCGTCGCGCTGCGCGCACGTGGTCGTCCCGGGAAGCTGACGACGCCGGTCTTGCCGCCGC
CGACCAGGACGCGGCTCTTCGTCGAACAGCCATTCTGTACATGACACATAAAATAATACCATACAAATCACAAATGTGTGCTATAAAAATATACAGCGGG
TCATTCCTTCAAAGCAAACCACACACACATGTAAAAAATACAACCAAGGCACATCACCATACGACGACTTTGCTGTAGACTCCATTCTTACAACGGCGGC
GCATTTGGATGAAGGGAATATACATCCCCGACCGATTGAAGTGATGGCCATCATCCGGATAAAAGGATGAGGGGTTGTATGTTATACAAAATACAAGTGT
GGGTGAGATCTTCCGGATACTGGTGCTGGGCGGCTGGTCGAGCATTTTGCCGTTTGCGGGCATGCGCCAACGCCGCCCGTTCAGCTTTCTGCTTTGCGCC
ACCCGCATGTGCGTAGCTTGGTCGAGAAGAAAGGCCATGCATACGTCGGCTTCTGTGGTACGGCGACCGCGATGACAACGATGACTCGTGCGCTCTCTTG
TAGGACCACACGCGCTATGCGTAAGGCTCGAGGAGTCTTGTCACGAAATTCCACAACTTGCCGACAACAAGGTATGCCCATTGAGCTGCGCCGATCGAAG
CGGAGCCAAGCGGCGAACCCGCTGCAGCCATCCACGCCTGGCAAGCCGTCGAAGCCAAGCGCACCGACGACGGACGACGCGACGAAGCTCGCGTTCGACG
CGCTAGTCGAAGAGCTCATGGCATGGTTCAAGAATCGCAACGAGCGGGTACCTCTTTGCGGATTCGCAGCGCTGGCCATGCGCGAACGACACGGCTCAAA
GTCCAAGTGGTCGAAGAAGGAGCAAGCAGCGTTCGCAGCGCTACAGGCGCTGGGCAAGGACCAGGACGACACAACGTGGTCGCTGCTCCGGACCTTCTCA
AATGACGGCGACGAGAAGCTCTTCACGACTTGGTACGTCTTCGATACCACCCATGTCGTCTATCGTTGAGGCGCATAGCTTTTGCGCCGCCCGAGACCGC
AGCCACATTGTACGGACCTCGATATGTCAACCAACTGCGTCAGTGTGTTGTAGGCTCAAGAAGCAGCAGGAGACCACTGCGAATGCCGAGAAGAAGCGCC
ACCCCGACGACCAAGCTGCACTGTACGTAGACGATATCGAACTCAAGCCACAAGATGGCTACGACATGTATAGGCACGGGGATCCAAAAAGGCCAAGCTC
GCGCTGGCCGCCACGTCGCCGCCCGCCATCGGCGAGGCCAAGGCGATCCTCTCGCAAGACGCATGGATCCAGCGTCAAGACGATTTACTGCAGCACCAAG
ACGCATGGCGCTGCATCCAAGCGTCTTGGCGCTGCATCAAATCATCTTGACGCTGCACAAGACGCTTGGATGCAACAATACGATGTCCAGATGGAGCACC
GTACGGATTCGATTTGTCTGCGCTTGTCGTCGGCATCACGCGGCGGGCGCGAGAGGGCGTCGGCGACCACGTCCTCGACACGAGTTTAAGCTCAAACTAA
GAAAAACAATCCAGCTATTGGACTATCTTGGCGTTGAGCAGAGGCGTTTCGAGGAACAAGCGCCACACGCTGCTGACTGTGAAGAGCGTGAACGGCGTGG
CCAGAGGTACGCCACTTGGCCAGTGCCATCTTGGTCGCGTAGAGCTCCTTCTCGTGCGCGCGCCAGTTGAGCTCGGCACTAAAGAGCTACTTCGACGAAC
GCAATCGGGTGGTCATCGCTGGACTCGTTGACTGGAGCGCATTTCGCGTCGGTCGGTCACTGCTCAATGGCACAGAGATAGTCAGGTCGACCGCAATGCC
ATCGCGCGTCATCATATGGCCGAGGTAGTCGATCTCGGGCATCGCAAACTTGCCCGTGGTCATGCGGCAGTAGTTGTGCGCGCCGCATCTCAAACACCGC
GCGCAACGTGCTCGTTCAGCGTCTTTCAGACGATCGCAATTCAGTCCATGTACACGACCGCAAAGTCGAGCCTGCCAAGCGCTTCTTCATGAGGCCTGCC
AAGCGCTTCTTCATGAGGCGTGGCCTGTCATCCCCATCGACACCATGAACCACTCGTACGTGTCCGAGTGCCGTGAACTTGCGGGACTCGGGATCGACGA
GCATCGTAGCCCGTTGCAAGGTCGAGCTTCGAGACCCACTCGGAGCCCTTCATGCGATCGAAGAGCGCGTCACGGGATGCGTGGGATCTCTTGCTGCGAG
CTCGTGTAGAGGTAGTCGAGCACCCATCGGATCTTGGACTGTGACGTGAGCGACTTGACAAGCTCTGCAACAGTGGCTTTAATGAGACAGTCCTCCTCCG
ACCGGACCGCGTAGGTGCCCTTCGTCAGGCGCGGTGGTTACCGGAACGACGCACTGACGACTTGGGGTTGACAGCCGTAATCATGCGAGTGCGCCAGTTG
ATCGTTGAGTTGTACTCATAGAACTACGAAAATGGTGTCGACAAAGTCCCACGCGATCCTCTCAAGCTGCGGGAACGTGTGGTTGCCGATCGCGACGACA
TACACGGGTTGACCTGCTTCTGGACGCTGCTGTTGAGTCCGCCGACAGCCTCGACAATCGGGCCGCCAAACGTATCGCATATCGTTGTAGGTTCGTCGCA
CCGCAATTGAGGAAGGCGCGAGCGCCATGGCCGTCAATCGCGCCGTTGGAGATCATGAGCTCTTGTACAACAGCTCCATGTGGCGCGGCTATTGTGTTGA
CCTGCACCTTGGTCGTCTTCGCAGGCGGTTTGGACGACTTGGGCGGCTTCAAGAACACACACTCGGGGCCGCATCCTTGTCGGAGAAATCAAGACTACCT
TCCAGGCCGGGTCTTCACTGAGATCGACAACACCAGGACCTCACTGGGATGATGCCTGCTGCGGCGCGGCTTGGCCTCGTCCTTGGCGTCCTGGTTACAA
CGATCGTTGCGCTCACGCTCGTCGCCAAAATGCACGTTCAAAGCAGACATGCGTCCGAGTGAAAGCCAATCTCGCGGAGACCAGCTCCATCTTCGACTGC
GACTTGAGGCCACGGATGGAATACGCGATCTTGTTGGTCACCCGCACCATGATCTTGCGGAGCAGTTGGACGTGTACTCGTTCAACCCACCCCGCAGTTG
CGTCGGCGGAGATTGGACAAATCTTCACGGAGCCGTTCCTGGATGTCAACTCTTTAGCCAAGCGTCTTGAACGGGTTGCCAGCCGTAAACTAGGTGCGCA
CCCACACAACGGTCGGTGAACGCAAGCTGGAACAAGCGCATGTCAAAGTTGCTCGGGTCGGACGAGTCGTCGGCCGTCCAGCGGAGCTACAACTGCTGGT
AGTGGAGTATGAGGTCCTCCTTGATGGCACCGCAGCGGCTGCACATGGTTCAAGCCGTCGCGCTGCTTCGCCGTCGCCTGCTGCGTGAGCTTCTCGGTGG
CCGTCGTCATGCTGACCAAAAGCTGGAGTGCGTCCTTGGGAGCGGTGGGAAATCTCCCTCCATCGCGACGTTGTCCTTCGACATCCTTTCGACTGTTTCG
CTTGGGCGGCCTTCGCCGAGGCGGCTTCTCTTGATCTTCCGACAGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN