Description :
From Genome Similarity Track
Location :
Scaffold_984:1268- 2566
Sequence
1298 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAATGCAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATC
CACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATCCAGCAATAACCACGGACGCAGAGTGAAGATCTTATCACTGATGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACGCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTAAG
GAAAGCTCGGTAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCGGCAATCTCGCAGATTTTGCTG
ATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGG
GAAGAGGCGTCGTCGGAAGTCGGATCGACAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAAAAACTCTGTTGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTAATCAAAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCA
ACACTGTACCTAAACCCAACCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCGGAGTCGGAAG
AGGGCCAAGCTGGATCCAGGTCAGGCTGGTCAGACAAGGATCTCGAGTTTGTGTATCACCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCAT
GCAGATCCTTAATCCACGACAGATCGTAGATCCAAGAGAACCGGTGAGAGCGCCAACGAAAACGGCGAACAGGTTGGTGGCAGTCCAAAGATCTATTACT
TTTGCTTAACGGATTTCAGACATGTTAAGCGGGGTGTTTTGCGAAGCAGAGAGATATTCTTGGGAGCTGAGACCTGGATTATCATAGTTTTTCGCGGGGG
CGGGGGGCCCTTTTTTTCCCCAGAAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCC
TCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCG