Description :
From Genome Similarity Track
Location :
Scaffold_270:1268- 12336
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_270-snap-gene-0.8Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_270-fgenesh-gene-0.5Transmembrane protein
Pytve_DAOMBR484maker-pve_contig_270-snap-gene-0.9Conserved gene of unknown function

Sequence
11068 bases(100 bases per row)
ACCGCGACCCTCGAACGGCCCGTTCAGGAACACGAACTCGGCGTTGTTGCCGAGCGCCGCCTGGATCCCTCGCGTCTGCGCCTCCATCACTTGGCGGTTC
GTGCGGAAGCCGTGGAGACATAGCACGCGGAGCTTGCGCCGCGGCGCCGCGACGTGCGCATCAGCGGTCATGGGTCGGGCAGTCTGTATCCAGATGCGGC
GGACGCTGACGCTGGTGCTGACGCTGGCGCGACGGAGGACTGGATTCGCAATGAGCGAGTTGCGCTAGTGTCGACGGCGGCTTACCACGTCAAGTCGCAG
TCTCGAAACGTTTGACGTCATCGAGTTTGCTTTCGCCAAATTTGACAATCATTGTGATTGGTTGTGTAAAAGTATTTTAACCAATGGAGAGCCGTTCTAC
AATCATACTCAAAACAGGGGATCGCGATTCGCGAGAGAGCACTGCAACCGTCGACCAGTTCGTTCTTCACAGACCCGTCATCCGCAATGGCTGTGCATCA
TCTCGGCAATGGCGGCGTAGAGCTCGTCGTGGCGCTCGCCAGACGGAAACCGGTGGCCGCCGTCGTGCTCGAACACGAACTTGGGGTGGTGAGCTCCCGC
CGGGTGGTCTTCATACAACTCGACGTGTTCCTTGCACGTATCGTAGTGCGTGTCGGTTTTCCCAACCAGGTGGATGGAGGGGATCGGAACCTTCTTACCG
GACCCGTCAGGGTGTTCGAAGAGCGGCCGCAAGCCAGCGTCACGCACTCGAGTCCCGCAGCAGATCAGGCAGCATTTCCAGTAGGATGTCTTGCGGTGGT
GCAGGTAGTACATGGTCAGCGCCGTGATCATCTGTCCGCCTTGAGAGAACCCGACGGCGACGTCGATGGGGCCGTGCTGGCGAAGCTGCTCGTCCATGAA
CCGCACCGTCGTGTCAAAGCCAACGTATTGGTGGTACCACCCGTTGTCCTGCACTGCCGGGTCGCGCGGCAGTCGGGTGATGTGGCCCCACTCGTAGAAC
GGTCGGTGGTCTTTGTATCGCTGCTCCAGGATCTCCTCGGCCGGACCACGAGCCACGAACGGCGCGTCCAGGTACACGAACTCTGCTTGTGGTCCTAGCG
CCTTGCGAAGCGGCCGCGTTTGGTCCTGCATAACCCGGCTGTTGGTGCGGTATCCGTGAAGGCACAGCACTCGCAGTCGTCTGGCGACCATCTCAATGTT
GGTGGACTTCGGCGGGTATTGCGTGCGGGTCGGGACTCGCGTGCGTGGCGAAGAGGAAGTGCCGAAGTGAGCGACATGTTGATCAGTTCTTCAAGCGCGC
ATCACCCTTTTGGCCTCGGTGGTGTCCCCGTCAAAGTCGCTACTAGTATGTGTTCGCGCAGCGGAAGTCTGGAGCGCGCCAAGGTCGGCGTGACCGAGGA
TCGAGACCTTAGACTCGCATATGCGGGTGTATAACTCAAGATCTCGGCGCTCTAATATTGTACTTGATGCTCGCAGTGCTGCCGGATCATCCGCGCTACG
TCCTCGTACAACCCGACGTGGCGATCGCCGGACGGAAAGCGGTGGCCCGTGTCGTGCTCGAACACGAACTTCTTGAGCGGCGCGCCGTTGGGTTGATCCT
CGAACATGTCGGTCATCTCGAGGCAACCCTTGTACCACTGGTCCTGCTTGCCGATGATGTGGATGGACGGGAACGGCAGCAGCTTGGGCGAGCCGTCGGC
GTTTTCGAACAGTGGCCGCAGCTTGACGCCGCGCACGCGCGGACCGCACACGAGCACGCAGCACTTCCACCACTTGGTGTTGTGCTTCTGCAGGTACCAC
ATGGAGAGCGCCGTGGCCATCTGCGCACCTTGCGAGAACCCGAGCACAGCGTCGAATGGCCCGAGCTTGGGCAACTGCTCGTCCATGTACGCGACCATTT
CATCAAAGTCGACGTAGTCGTGGTGCCAGCCCTGGTCGTTGTGCTCGATCGGGGCCTCGCTCTTCTTGGGACGCAGGTCCGTGAAGGATCCCCACTCGTA
GAACGGCTTGCTGCTCGCGTACCGCTGCTCGATCACGTCTTCCGATGGCCCGCGCGCCTCGATCGGTCCGTTCAAGAACACGAGCTCGGCGTTAGGCCCG
AGCGCGCGCTGCAGTCCTCGCGTCTGGTCCTGCATCACCTCCACGTTGGTGCGGTAGCCGTGCATGCACAGGATGCGCAGCTTCTTGGCGGCGGCGCGCG
AGCTCATGGTAGTTTGAGCAGCAAGAAGAAGGTCGACAGCTATTCTTGACGTGGAGCTGGGCCGATGTGCAAGTGGCGAATTGCTCTGTGGTTCTGACGC
TGGTTGACGTCATCACGTGAAACGCCGCATCCATCCCATCCTCAAATCAATGACGCTCACAAAGAGACTTTACTGGTTTAGTGACGGTAGCCATAGCGGT
GCAACTTCAAACTGCACCAAGGTAGGAAGAATTCGCAGCATTGACTCGTTTGCTCGGATTGCCAGTGTGCATTCACCTGGTCAGTACATCACCACACACT
GTTCTGACAATTACCGAGCTCAAAGGGACTGGACGGTGCGCGTAGAATGCGACGTACAGACATGTTACCACAACTCAACCGATCGAAAATGAAGACATCC
AATGAAAGCAACTCGACGCAACTCACAGGCGCGCTCCTATCTGGGCACCACCGGCAGAGTGGCGGAAGAACTGGTGCACCATCTGCGCGAGGCTGGCGTA
GAGCGGCATGAACTTGCGCGGGTGCGGGAACCGGTGTCCGCCGTCGTGTTCGAGGACGATTCTCGCCGCCGCGCAGTCTCGTGGATGCGGCTCGTACATC
TTGGCGAGCTCGATTGTCTCGTAGTAGATCAAGTCGCTTGTCCCGGCGATGTGGATGGAGGGGATTGGAACGAACTTGGTGCGACCGGCGGCGTCCTCGA
ACAGCGGGCGGGCATTGATACCGTGCACGCGGACACCGGCGAAGCAGACAGCGAGACGCCACCACTGCTGGCGGCGCATCTGCAGCGACCACGCGGCGAA
GATAGTGAGCATCGTCGCACCCTGGGAGAAGCCGACAGCCACGTCGAACGGCCCGAGACGGCGCAGCTCCGCCTCCATGTACAGCAGCGAGCGGTAGAGG
TCTTCGAACCAGAGGTTCCACGTGTCGCTCTTGCTCGATATGATGTCCGAGATGGCGTCCGCGACCTCGTGCGTGTCCAGGTAGCGTCCTTGCCACCACT
CGTAGAAGGGTGCGGTCTTGGCATACAGCTCGAGCACGAGCGGGTCCGGATCGCCGCGCGCCATGAACGGTGCGTCCAAGTAGACGTACTCGACGTTCGG
GCCTAGCGCCTTGCGGAACCCGACCATCTGATCCTTCATGATGGCGGCGTTCGTTCGAAAGCCGTGGACACACAGGACGCGGAGTCGTGGGTGGCGCGAG
CAGGTCGACGGCGCCGGCATCGGGTCAAACACGAGCAGTGCTTGGGCTGGAGAGAATCGAAAAATGAACTCAAGGTCGTGGGAGCTCGGCCACCCGCGGC
TCCATGTCGACATCCCTCCCGACAGCAGTGGAAAGCAGAAAGGCAACATTGCCGCTGGTTCCTTGCCTTGTGATAGAGCGGCCGTCGAAGTCTGGCGGCG
GCGGCGTCCGCAACGCACTAGCGTAGACAGCTGGCCGCATCTTCCTGTTGCCATCGGTTCAGCTGCATCGCTGTGGCGTTAGCTACAGAAACGAAGCCAA
GTCTCCGGTCGCTCACAGTGCCTGACCGCGCTGCGTGCTTGCTTTCGCTCGAGCCGCCGCGACTTCAACCAGGACTTGCCGTTCGATTCGAAGGAAATGA
GCATGACGCTCGTCATAGTGCCGACCGCCGTAATGCCGATCGCCGTCGGTCTTAGCTGCCGCTCTCCTCTTGTGGTGGCCGCGATGACGGTGCGTCTCAC
TCGATTCTGCAGAGGTGCAACTGAGACCGTGCAGGGTTGAAGAGGTCGTACCGGTACTGTTGGACGCCGCCAGATTATCGAACTGTCCACCGAGCAGTCG
ACACTCGACGTGTGGCTTCCTTCGGTCAGCGTTTCCGTGCCATGTGCTATGTGCTGGCAGGCCAGTGATGGTGGCGAGTTGGGCGATCGGAGAGCAGGTG
CAAGGTGAGATTCGGATGCTCTGTTACGTTGCTGTACGGCAACTTAGTGTCCTGACGCTGGCGAATTTTGCGCATTCGTGACATGTGCCAGGTCAGCGTG
CACATTGGCTAAAATGCGATATCTGCAATAATTTTTTGCCAATCCGTGGCTGCCCTACTGAACAGTCTGGCCAAAAAGGAGAAAGCAAGCAAAAGCGAGA
ATTGCGACGCTGGACCGATGAGCAAGACTGGGTGTGCGTGTGTGCGGCCTGCTGCTCCTATGGGGCCCCGCTTCCCTATATGCGAGATATACTGACACAT
GTGTATACGTGTGTGTGTTACTGGTCTGCGTAGGGTACTTGACGGGCGTGATCTTTAGCTTCGCGGGCTTCATTTTCCTGGTGAGTCGGTCGTCATCGCG
GGCGTGTTTATTGACCCATCCAGCGACGTCCTGGACAGCCACGCGCTGGGTTCTTTCGCTCTATCGAGTGTTCAATGGTGCTGACGATGTGGCGGCGCTG
TTTGTGTCCGGTTGATTGCTCGGTAGACGATCATCGGCGCGCTCCTTAAGCTGCAACCCAAGTTCGTGCACCATGCCAAGTCGCCAAGCTCGACCGCCAA
CTCCTGCTTCGAAGCCGGTGCGACTGCGACGGTCTGTTGTTCTATGATGTGTTTGGTAGTGGACTTATCGCTGTGTGGGCTGCTCCAACAGCGCTGCTTT
ACGCCCTCGCCATGACGTACTGCTATGTGCAGTGGCGGAGAGAAAAGATCCGCGCAGGCGAACTGGGACTCATCTCAGAGACGTTTACCCGCGAGAAGCC
GTACCACTACGAGGCCGAAGATTCGGACGAGGAGCTGCCGCTGGCGCAGAACATGTCGCCGGCCGAGTACACGCCAACTTCCACCAAGCGCCTCGGTCTC
TCGTGAGCCGACAGCGACCGATTGACAAGAGCGCGCGCGGCAGCTGCAGCTACGGCTGCAGATAGAATCCCCGCCCGACCTTGTCATGTGCTGTGTGTGG
AGTTTATTTGAATACTTTGACCACAACCTCGTGTTGTCTTGATTGAGGAGTTGCCGACGCAACAGCGTAACCTAGTTCGCCAAGACAGCTCCTCTCGTTG
GTCGATGCTGAAGCAGATACGCTGTCTTGCATGGGTGGAGCCTTGCATCACAGGCTCCACGTCGTCATGAATGTGGGCAAAGGTGCAGACTTGAGCTTCT
AGTCTATGTGCGACAATGTGCTGGGTGGTCCAGCCATACCATGTACACCACGCACACGTGGATGGATCAGGAGCGTGACCGAAAAACGTCTTGCCAGCAT
CCGAATAACGCTAACCAGTTTGACGCGGAGGTGCGCTCCCCCCTTTCGTGCCCCCTCGCTCAGTGTAACAAGTGCCCGTCTAGAGGATCAACCTCGAGTC
GGTCTTCGATCCGGCGCTATGGCTTGGCGAGCAACTCCGATCTTCTCGGCCACTAGCATGGACACTCTTCTCGGGCTGACGTGGCCGAAGCGCTGCGATT
TCCACATTGCCAGCCGCGACTTGCGCGGCTTTCTCCCCATGCCGGCGAAGCAATTTGGGTACGTCACGGTGCCGCGCAGCACGATCAAGTCCGAATTGGA
CGCCTTGGCGACTCGAAACAGCAGTCGCAGCGTCCAGGGGACGAGCGTCACCACTCGGCTGACGAAGAACGGGATGATTCGGACCTCCACTTGGCTGCCC
CACACCATCGCTCGCCACAGCACCTGGTCGTTCATACTTGTTCCAGTGTGGACGAGGACGTGATAAACTGTGGCGCACTGGCTGATGACAAACACCACGA
CGACGACTGTGACCAAGTGGATGTGGAAGCGCAGGATCTTGCGCATTCGCGGCGTCAGCGCGTCCAGCGTCATCGCCCAGTGGATCCAAATCCATAGCGA
CCACACGATCGCGATACTTGTCGTGCTCCATCTGTGCAGGACGCAGATGCTGATGTGGACGGCTGTGAGCTGAATCGAGTAAAACACAAAGTCGAACGAG
GTGAAGAGCAATCTGAGCAGCTGTCGCTGGTAGAGCGCGCCGAACGTCAGCGTGAATACAGCAGTGCAGCCGAGTGCAATCCAGCCGCGAAGTTCGCAGA
CGTCGGAGCGTTCGTGCAGCACGTGGGCGTCGAAGCCATCTATAAAGCCAATGCACGCGAAGAAAAGGCCTGTTGCACCGATCAAATACAACGCCACTGC
AGCGAGAATTGGTAGACGAGGCATCAGGCCGCTTTCAAGAGGGAGAACCGTTCTGGAGGCGTGAAATACTCGATTGGACTTGACGAACACCATGCGTTGA
ACGAACTCTGGGCCACGAGTGCCAACTTTCGTCGCCTGAGCTTGGGGAGGTGGAGGTTGAGGTGGAAGTTGAGGTGGAAGTTGAGGTGGAGGTTGAGGTG
GAGGTTGAGGTGGAGGTGAAGGCGCGATTGCGGCAACGGGAATCGGCTGTGCAATGGCTTCTAGCGCCGGGAACGCGTATCGCTCGGACAGTTGCAAACT
GCAGCGATAGATCGCGCACTCGATCGTGTCCGTCTTGGCTCGGGGTTTCAGCAGGCGTCGCTTGCGATACACGATCGTGGAGAGCAGAATGCTGATCGTG
ACCAGGCCATTGGCGATCACATCCGTCGCCTCGAGGTGGTAGCGGTGCTGTTTGATTTCATACTCGACAATGGTGAAGTTGTTGACATCGTTCACGCGGC
GCAGCACAATGCACACCAGCAGCATGAGCACGGTCGGGATGCCGATGACCACGAGCTTGGCCAGCTGTCGGATGCCTCGGAGCTGGGAGTCGATCATGAC
AATGTTTTGGAACCCAGTCCAGTCCAGCAGCAACCGCGCCGCGCGTAGATCTCGAAACACGAGTGCCACGATCACGTTCGTCGACGTGTTGACGATCAGA
AAGAACCAAAAATCGTACGTGCCCATCAAGAGCCGCACCACATCGTAGCGGAGCGTGCCGACGCTGCCGAGTCCGAGCGGCAGACACAGGAGACCCGCCA
AAATGCCCAAGAACTTGCCGGTCTCGGTGTCGATCAGAGGCACGCAGAAGCTGCAGCAGAGCGCGACCATGTACGAGAGCACGATGAGGCGGTTGTATTT
GACGAGCACGTGGTCGACGGCCGCAAGCACGCGGCCATGCAGGTACTTGGACTTGAGTGACTGGGAGAGGTCGACGATCGGCAGCGGCTGGGACGGAACC
ATTTCGTAGACCCACTCTCGGCGCGAGCCTTGATCTGCCGCCAGGACCTGCGAGCTGTTGTTGCGCGGGCCAGCCAGGTCGACATGGATCCGCGACCCAG
GCTCACTGGGGGCTGTTCGTCCCATGGACTCGCATCCTCTGTAGTTCGGCAGGCGGAGCGAAGTCTGGTCGTGCGCGAGGGAAGGAAGTGTGCAGCCTCA
GCTATTTTTACGGTGCCAAAACGGCAAGGACGAGATCGAGAGTGAGCCGGTCAGGGCGAAAATTGCGGCGTAGATTCCGACTGCTGTTCGGTGTACACTG
AACGGCGATGACGCCTTTCAGTCTAAGCCGACTTTTGGCTGTGATCCCTTCTTGCTTGTGAAATGTGCGAGCAAGCGTGAACCAAGATCGGTTGGAATCA
GCAGGTTGCGCGTAGGTGTCGCGAGCACGAAACGGCGTCGGTATCCGATCGTCCTGCTGCAACCACCGCCGCCGCACAACATACCACAGGAGCGTGCGTA
AGCCGCCACAATGCAGGACAACAGTGGCGCTGAGAACTCGGCGAGCGCCAGGAAGGCGCTAGCGAGGGCACAACGAGTGCTGCAGGTCGTGACGGCGAAG
CGGAGCGCGCTGGCGCTGCGCGACGTACGCGAAGTCCTGGAGGTACAGCACAGACAGTAGCGTTCACATTACCGCCAGAAAGAGGACGCAGATCAGCTAA
AATGCTCTGGTTTATAGGAATGTCTCAAGACGGAGGCGAGCTCGCTGATGAAAGTGATCGGGTACCGCATCCTCGCCAAGCAGCCGACCTGTTTGGACCA
CGACGCGTGGAACTTCGTGCTCGAGTCGTGCGTGATGGAGCTGGCCGGTTCCCAGAACGCGCCAGTGTTGACATTGTCGATCCCGATATTGGAGCAAATC
CCGCTGCCGCTCGTACTGGGGTTCCTCGTGTCGACGGAGAAGGAGCCGATGAACAAGCTGCGAGCGATTCTCTCCCACGAAGACATCGATGTGCGCTGCT
GCGCGATCGGCACTCTGTCCAGGATCACGCTGGAGATCGCCGCCAGCATCACGAACGGCGGGCTGATGGTGTTCCCGTTCGAGTCGCACGAGGCTCGTAT
TTGCTGTCAGCAGGATGTGTGGACCATGGTCGTCGACGTGTGGAAGATCATCTTCCAAACGCTGCTTCTCTCTGACGTACACTTGCAAGACGCGGTCGGC
GCAGCATTTGCTGCAATGAGAATGCTGTTCGCGAGGACATCCGCCATGGCGCATTTCTTCTCACTTACAAAGACGCATTCTCGAAACCAGGCGGCGATGA
ACGACATCGCATCAGCGCTATACAGGGATGCCTACCCACTCGCACGTACACTCATCGATGCTGTGCACAAGCTGCCGATGAAGTATCAGGCGACTGGAGC
GGTGTGGATCGCCACGTTGCTCTACATGATGATGGAGCGGACGGGAGCTCGTTGTCCGAGCGTCAGTGTGCCGTACCTGTCTCTCGATGTGGTGAATGCT
GGTTCCGATAACCTCGATCAAGACGAAAGCGACACATCATCAACGGAGAGAGTCCGAATCGACCAGCTCGTTGCAGAACAGCTCGAGTCCTGGATGATCC
CGCTGTTGTCAAGCAAGACATCGCTCTCGCAAAGCTCCAGCATTTGTCGTGCCATTTTCATCTTGCTGTCTCATCCGATGCAGGAGTTTAGTCGCCTGCC
GCATAGCGCAACCCTGGTGAATCACATGACTGCGCAGTGTGCGTTCAGCAGGAACAGCGCGACCAAGTTGGAATTTGCCCAAATGCTGGTGCGAGCATTT
TCGTGGCTGTCGAGCGCGGGGTGGCTAGTATGGTTCACGCGAACAGTCGACGCTGTCTTTCTGGTGGACCGTGAAGCGTACGTGAATGTGCACATTTTGC
TGTTGTTTCATATTTCGTCGCTGTGTAACTGATATTGGATTCTTCGTGGTATCGATGCAGCGATCGAAACGGACTTCTTAGCACGTTGATGGCTGTGATT
GTAGAGCGTGTCCGGAAACACCGCGATTTCCAGCTTTTGGAGTCGATTTGCGCGATCGAGAGTCTCACTCAAGGTGGACTCAAGCTCACTCAAGGCATGG
TGCTCGCCGATGTCTTCCGCGCTCTCGTGCAAGCCGCTGTCAATCGTGAAGATCGAGAATCGATCGACAACACCCAGGCTGCGTTTGGCGCTCAGCTGAT
TATCTTGAAAGTGTTCAAAGCTGCTCTCACACCAAAGAGCCCGGCCGCTTCGAGTGACCTTGAGTCCCTAGAGTTCAAAAACAAGAGCAGTATGCTGCGC
AACTATATGACGCTGATGACGGCACACTTCCTACAAGGAGCAGAGAACTCGGTGCCAGCATTCCAAGAATCGCTTGATTACTTCCGCAACGACTGCCTCA
AGATTTGGCGCCAGATCCCGTCACTCCGAGCTCGACTCCAGCTTCTCTCGATCGGGATCTATTTGGTGCAAGAGTATCAGCTTGTTCCTCCCCAGCTTGT
GCTGGATGCAATCAAGTACGAAGTCGCTGCGACATTCACGGTGTCTTCGGATCAAGACAGCGGCGGCGGCGGCGGCGGCGGCGGTGGAACCCACGCGACT
GTGACGATGACCGCGTTCGACGATGGGAAACTCGGCAGCGGATCAACAACCGGCGGCGCTGTACTGGACTTTGTCGCTGGTCAGGAGCGATGGACGAATG
TTGACGCTGTAACAGCGATCGTGGAGTGCTTGAAGCACATGGCTCGCATCTATCCGCCAGCCACCTCGCAACTGGCGCCGATATTCCAACAAATGCACGT
CTACGCAACTCGAAGCTGTCCAGTGATCCTGCCATATCACCACATGTACGCCAACGTTGTTGTGGGACGGCTATTCATACACGCATCAGTTCCTAACTAC
CATTTCTGACCTGCATAGACTGGAACAGCAGCTGCAGACTAGCACGGACGTCACGAAGGGATTCTTCACCCAGTCCATCATGAACCCATACTCTGCGTTG
CATCCAGAAATGGAGAAGTGGAACTCGCACACGGAACCGACTGAGAGTTGGAGATCTGTCAAGACAATCACAGGCAGTGGTGATCCGCTTGCCATCCAGT
TCGCGTATTACCAGCCGTTGGACGCTAGTCTCGATGTTGTCGTGCTGCAGATCACGTGCAGCAACTTGACAAGCCTCTCACTCAACGATTTCGAGCTGCG
GGTCTGTCCGATTGGAGATACCGCCAAGTCAGTCGACATCGTGAATGATTTCAAAGCGCGTGTATTGCAAGCGGGCGGCTCAGCGAGCTCCAACTTGCTT
CCGTTTGGTACCGTCCGAGTCGAGAAGCGTTTTCAACTGTGCAAGTTTACGCAGGCGTCGTTCCTTGTCCAAGTTGCGTTCATGGAAGCCGAGTCGTCAG
AACAGCCGTCCACAGAGCAAGTTCCATTGCAGCTCGCCGTCTCCGACCACTTTACGGTCTCTTTCGACGCACTCTTATTGCAACCAGTCTCGCAATATGC
GACCGCATCGTTCTTCCAATGCCAATGGCAGAGGTAAGTGCGAGCTCCCAAACAAGGTTTGGATTGTGAGCTGTTGTGAACTCACGGTGGTACCTTTGTA
GCGCTGAAGCAGCCATGGTGCTCCCGGTTCGCTCGACAGGACGCACAGATCCCCCCACAACCTCGTCGGAGGCGCTGTCATTCTGTCAGTGCGTGATCAA
ACGGCAAAGTATCCGTGTGGCCGTTGTTGCCGAGCTGCTGGTTGACCTACCGTTCTTCTTCCATGTAA