Description :
From Genome Similarity Track
Location :
Scaffold_41:126774- 128109
Sequence
1335 bases(100 bases per row)
CGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGG
ACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGA
TACTATGAGATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCC
ACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGA
AGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCAT
CTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAATCGGTGAATCTGCA
AATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTACGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGA
GAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAG
CGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAA
GATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAG
GGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAG
TGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAA
TATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACT
TGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGA