Description :
From Genome Similarity Track
Location :
scaffold_16:126773- 131490
Transcript NameFunction/comments
Plaha_PHALS_01050CRN-like protein
Plaha_PHALS_01051hypothetical protein

Sequence
4717 bases(100 bases per row)
GTTGAAAAAGACTTTTCAGAGAAGAAAAATACGGAGCTTGTGCTGAACTGCATATCAAGCATTTATCAGAATGATCTGCTTTGGGCCTTTGGCTTCATTT
GCCCATTACTCGAGCATTGAAGCTCTGCAAAGCGCCAAAGGCTCGACAAATGATTCGATTTGACAATGCGACGAGATTTAGCGTGAAGCCATGCTACCGG
GAAACTGTTTTCGCTCTGATTGATAAAATAGAGGCAGAGAAAACCGCCTTTCCGTTCTTCGTTCTGGATGTGTTCTTACGAGCATCATCCATGGCGGGAA
TCTTTTCCATAGCGTGGTAACATACTCAACGATTTCTCATCGATCCTATAAAAAGCGCTCTTTATGTAGTCATTTTAAGCGATGAGTTTCATCACGAAAA
CGGCAACTAAATCTTCATGAGCCCATGACGCAAACGTCATCGCTCTCACCGCAAAACATACGACAGAGCCTCTCACTGAGGAAGAAGCATTTTCGACACT
TTGCCTCTCTTACACTTTTTGTTCATCCTAACGGCAAAAAGTGTCACGATTTCCGTGGCGGAATTCTCGACGACACCCACTTTGAATTAAACGATCTAGA
TCAGGCACACGGAGTCCAGCTGGCTCGTTGGAAAGCGCAAGAGTCGCGATAATTCCCGCAGACCCGATTTTTGATTTAATCCATCAAAACATTTATGAGT
GCACCATGACAGAGTCTTCACACGCCCTTTCCGCCTAAACACAGAGCGTGACGAGCGCTCGGATATTGGCACGCGAGCGCTTTCCGATCCTTCAGATTAC
CACTCAACAGTAGTTTGTAGCAGCGGTAAACTTTACTTTTCATGAACCGTTTGACGCTTGGCGACCCTGCCACTTCCGCCCATACGATCAGACCAATGAG
TTTTCCAAGTCGTTGCGACAGCGGCACCAGAAGAATTTAATCAATGCGGACCTTCAATCTCCAACGAGCTTTTTCCCTTTCACTTTATCGGATAGTGAGC
CTGCCGGCCAAGTATCTAGTACGCATGGAATTTAGCCACGCCTTGCCTGTAAGCACCACCGACAAATAACGATTTTTATTCAGATTACTCGTGTGAGCTC
TTACGGTTATGGCGACAAGACAATTCTCACTAAGTCTATCTATCATTTACTTTCTTAAAGTTTGGATACATTTGAAATCGCACGACTAACCTTCATTTAA
TCAAATTAGTAAGATAATTTGAAAATAATTATTGATCAATGTATTACTTCTTGGCAAAGAATCaaacttcttcttctctgcaaTCGCTTCTTTTAATTCA
TCAGCTCGCATCCAACGTCATGGAGAATGCGTGGAGTGGTTGCCACGTCTCATCTTTCAATCAATCAGATGTAACAACACCCATGTAGATAAATACCTTT
AATATTGACTAGTTTGATGGATTGACTGAGTAGGACAAAGATGGTTGACTACTTCAACATTACCAGTACGTAACATCCATCATTATGTGTCGAATAGAGA
GAACCTACCTCACTGTAGAGCTCTCCATAGTTGAACCAACATTTGTCATTTGTGATCTGCTTGATTTCAAATGTTACTCGTCAGTGGCGTTGCCTATGTT
TGAGCATTGTTCATATGGGAGCCAGTCTGAATACCCGTGCTACCAAAATTCGTTTGATACcggaagatgacgaagccTTCGTACCCATGACACAGTGTAT
TTTGATCTTGGTTCAGAGATAAAAACTTCACTTGAATTTTGAACCAACACTCGCTTGATTTGAAGTAAAAGTAATTGAATTTGCTTAGtattttaattta
ttttttcatATGCGTGTTAGGTTCTTAAAATTTTGGATACATCTAAAATCACATAATAACCCTCAATTTATTATATTGgttaaatgaaaaaaaaatctaa
attgAATATTGATCAATATATCACTTAAACAACCCATCAAACATGTCAATAATAATGTAATTGATTGATGTTGTTGCATTGATTGACTAAGATGCGAGAC
CTACTCCACAGTTAAAAAAGGCATCAGCAAGAGAAACATGGTGACGCTTTTCTGCGCGGTTGTCGGTGAGAACGGAAATGCATTCCCTGTGGATATCGAC
ACTAGAAAGTCGGTGGGTGACTTGAAAAAAGCCATTAAAGAAGAGCAGATGTTTGATTTTGCTGCCAGCAAATTAGAGCTATATCTTGCGAAAAAGGGCG
AATCGTGGCTGACTGAAAAGCAGGTGGCCGAAGGAATCTATGACACGAGCGATTTCAAGCCATTGAAGGTTGTGGCAGCCTCGCTCCATTTGGTCGGTTT
GTCGGAGAAAGATGTTGCGTTTAAAGTTACGATGGAAGATGTCAAGACGATGAGCTTTCCTGTTAATGTCGTAGTGGTTGTTCCGATCGGAATGAAAAAT
ACACTGGCTGCAAATCGAAGAGCCGCATTATCAATAGCAATCTCAGCAGCTGAACCGACGGAAATCTTCGTCACAATTGAAGAAATCCGAGATTCAGAGA
AAGATTAGCAAGAGTTGATGTACTCTCAACGTCGTGGAcgtcttgtccaatacaaaTGCCGAGATTATTGTGCTCATATTCTGGACAAAGTCGACGAGTT
CTATGACAAGAACGAGCAATCAACCCCGTTCATCTACGTGGGAGGGTCATCAGGCATGGGGAGATCGCAACGTGCATTTGCATTGGGTGACCGACGACCT
TGGTATTACTGCCAGTTGGATCCGGTTCTAAACGTCTCTATAGCAATTTTACCTCAATATCGAACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAATTGGTAAGCACGAGA
TACGAAGAGTGAGCTTAACTGAAATTTTTTGAATGATGCATGCGAACGAGTGAAATCACAAAAGATATTTATTATTGAATGAAAGCTGCACTGACGCTGG
TCACTAATGCATGTCGCAACGATTAAACAATGAGCTAGAACGACAGCATAACAAAAAAGGTAATACACTCACTTTATCTAGTAAAATTAAAGTTTACGAG
AAAAGTGACGAAGTGATGACCATTCCAGTGATGTCTAGAAATCTTTTTCAAGAAGGAAAATGTCAATATATCAAATCTTGTACCCAACGTGCTAAGTTGT
AGATTTCTAGCATGCCACCTCTAGACTACTCGTTTCTATGACGATGCAAACAAATCTGATAGATCCAATTCGTTGGCCGCCCTATTTTCACTGGTAAGGA
ACCAAAGTGCTAGCGTATTACTTTAAGGTAACGGTAATGCTTGCGTTAAAGCTGGTACTTTCTACGTCAGGGCAGATGAACAAGATGATGCAGACCGCGG
GCGAAATTTGGACGTTCACACGGTGGGTGTGCGCACTTTGGTAAAGTAAAAGTCCCTCAGTCGGTGGTTATCGGAATTACAGAAAGAGTTCATGCATGGT
ATTTATCTCCCATCCCATCTTCGTCCTGGTGGGTTTGGCTGTACAGTACTCCTAGCGACCTTTTTACGAGCGCTTGCTTACCATAAGAGAGAACATCTGT
CAAATTCCCTAAGTCACCATACACTTCACCTTGCGAAACGCTAATCGGTTTAGTGAGGTCGCAGCGAGATCCATTGTTTAGCTATCTGGATTGGGCCAAA
GTGTTTCTTTCGTAAGC