Description :
From Genome Similarity Track
Location :
scaffold_717:12674- 14229
Transcript NameFunction/comments
g9974.t1 conserved hypothetical protein

Sequence
1555 bases(100 bases per row)
CAGGACAACATGGACCTCACGGCGGAAGACGACGACCTGCTCAGCTACTTCCTGTCCGCTGATGTGGCGGCCGAGCAGCCGCCGCAGACACGCCCAGCAG
CGGGTGTCCCTGTTGCTGAGACGTTCACGCTGGGGCAGACTGTCCCTCTGGCGCCGGAGCGGACATTCGGAGGCGAGTTGACGCCGGCCACGACGCCGTC
CGCCAGCTCTCCGTCTTCCGCCGCCTTCCAGCAGTCACAGGGAAGTTTCACTGAGAGCTCTATGATGCGGCCGTCCACCAATGATGACGATTCATCGTCT
AACGCCGGGGGATTGGACACGGACGAGAAGCGACAGCGACGTCTGGCCAGGAACCGCGAATCAGCGCGTCAGAGTCGTCGTCGTAAGAAGCAGTATCTGG
AGCTGCTGGAGGAGAAGGTGGGAGGCTTGGTTGTGCAGTGGGAAGAGAGGAATTTACAGTCACTGATGATGCTGACGTTCTGCAGGTTTCTCAACTGACG
GAGAGCATTGACACGACACGTGCTACGCATTTGGAACGTGCGGACGAGGCGCTGAACCAAGTGCGCTCGGATATTCTGAAGAGCCTTGTAGAAGACAGGA
AGAACGGCGGCTCCGAGGAGGTATGATACTGTGGCGTTTGGATGAAATGATGTGGCTGGTGTTGATGTACTTGCAATGTTGTGGCTTTAGACTGTGCAGG
AGAAGATTCGACAGGGTATTATGCTGATTCAGGAGCGATTCGGACCGAACAGTGTGGTGAGTAGCTTTGTGCTAAGCTTTAGCATGTGCTTGATGAGGTA
ACGCTTAGTTGTTGTGGCATCTTTGCAGGAGCGATTGGCAGTGAAGGACTATAACTTCCGCCAACTCGACAACTTGCTGCTTCCCCCATACTGCCGGTTC
TTGCTGTGGCTCAGCATCCAGGATGAATCATTCTTCGACGAAGCCAATGGGATGGGATCCAAAAACACGGGGGATGTGCCAGAGAAGAAGAAAGCTCCTG
TCATGGTGAAGAAGGACACGCTCTGGTCGACTCTAACGAACGATCTTGCCCTCACTTACGAGCAGGACGAGAAGCTGAAATCGCTTTACAAGTGAGTTTA
GTCGTATTTAGGCAATGCATGAAAGTGGTACTGATGCATGCATGTTTGTGCTCTTTTTGCAGGTCAGGAGACTCCAGGAGCAGCAAGTCGGAACGCCGAC
GGGTGGCAATGGCTGTGGTATGTGTAGTGAAATAGGGGTGGATGCTTGTTCTTCTGCTCACTGTTCTGTTTGATTTGGTCTGCAGACATATTTAAGCAAG
CTGAAAAAGAGTCTCGAGCAGCGCTCCGAGGCGGTCCAGCGACAAACGGAAATGCTGCACTCCATTTTGACTCCGGAGCAGTCGCTCACATATCTGCGAT
GGGTGGACGCCAACCAGGACCGACTGCCGAATTTCGTAGACAAGACGCTGTCGGTGCCGAACACTGGCGCTTCCGATGCGGTGCGTGCCATCCTTAAGAA
GGACGACCGTGATCTCACGGTGGAGGACGTGACTGCACTGCTTGGAGAGCTGTAA