Description :
From Genome Similarity Track
Location :
Scaffold_121:126709- 129119
Transcript NameFunction/comments
Hyaar_Emoy2810240PREDICTED: E3 ubiquitin-protein ligase E3D-like
Hyaar_Emoy2810242PREDICTED: deoxyhypusine hydroxylase-like
Hyaar_Emoy2810241PREDICTED: deoxyhypusine hydroxylase-like

Sequence
2410 bases(100 bases per row)
GCGAGTGAGAATGAGCTTATACGACCAGCAGCAGATGGTCTGGTCAATTGTTTGGAGACCCTAAACGTGACGGAACATGAGACAGGGAATGAGTGGTCAG
CAGCGCCCCGAATTGTTGACTCGTTGGTCGAGTACAACGCCAATATCGGCTGTTACCAGTGTTTCCTCTTTCTGTCAGACGACCGTCACAGAGATGATGG
CTACAAATTGACGAACGTCTTAAAAGCTGAGCACTTGCGTGTTCGAGTGGCATTTCCACATGCAGAACTTGGGTACAACGATCCTTTGGATCATAGTGTG
GACACGATCATCTGGGAAACGGAGATCGAGCGCAACGTGGATGTCACGCAGTGCACGGTCGAGCAAAAGGACGATCATTGGTATTTGAGACTTCCGATTC
GATTGAGTGATAAACAACCGCTTGGTGGGTTTTCGTCCTTTACGATGGTGTCTCCTCTCGAGCTGCGGGTAGAAAGTTACGGATCGTTGAGCTGTCGAAC
GTGCAAGGCCCAGCTGCTGGATTGTGAAGATAGTGTCAAAATGGACAAAGTGCTGCCGCTTCCGTCAGCGAATTGGATGGATATGTTTGACTTTTGGGGA
GCTGGCATTGGAGCTTTTGAGCATATTCCACGTGATCATATCTACGCACAGCGACATCGAGTCCTTGTTGGGGAGTCATATATACTGCTACATGCAAGTG
ACTTAGTGGCTAAAGCTACGACGGTAGCAGATGGTGAAGGCGAGGCGACTGTTGCACCCGGAGACAATGCAAAGGAAGAGCGCGAGTGGATCCCGTTGAC
TTGTGCAAAATGCTCTGAGCGTGTCGGTTTGCGCAACGTGGAGCAGCCAGACACCGTCCGTTTGCACAAGCACGTTCTTATTGCTCGTCAATTAGCAAGA
GCTCGTGCGGAAAAGGATCTTGTAGAGCAAGACCAGGAGGCGGAAGATGTCTTTGGCAAGTACACTATTGACAGCATTTTGAGCGCCAAGTTGTTAGAAA
TGGCAGACTCAGATGGAATTTTCCGGTTCGTCTTGACACCGTCAAACGACAAGCACGATTGTGTCGACTTGTCGTCTGGGAACCAAGGGGGTACGAGTGC
TCTCTTGCAATTACAGTTGCTAAGCTGGGAGACGATGATCAAGCAACACGGTTCGAATAAGTTTCGGCGAGTACTGAAGGTGCTATACGGTGGTCGTCAA
TCGACGTCAACAATTCAGGAACTCTTACCTGTGCATACAGTATTACTACCACCAACGATGTGCCTGACGATTGCCGATCGGTTACAAGCCAGCTCGAAAT
TACTGCCATCGTCCCTACGTACATTCAACCGGATGAATGTCGGCTATCTGTATAATTAAGTAGAAAACAATCCGACATTGCCATCGTCTCGTTGCAAAAT
ATCGAAATACAAAAAAGAAACAACATAAAGCATTGAAGCATCAGTCAAACGCATCGTCTTGCCTGTAATCAAGTACCTACTTGGTAGGCGCCCAATAGTC
TAAAATGTCGAGCGCCACGGCGCAACTCTCCCGCACAACTGGAACATTATCTTTGAGATGTTCGGTAAGGATCTCTTCACACTCAATCGTGCCAATAGCT
CCCAGCGCCTCTGCCGCCTCGTGACGCACCATTCGGTGCTGCGTCTCATCCAACAGCACCTCCTTCAGTGCTGGCACAACCACGGGGTTCTCCATCTGGC
CCATGACGTACGCAATCTCGTGCTTGAACAAATCACTTGGGTCGCTGAGCGCAGCCGCGAGAGCCAGTGCCGCTTCGTTCGTATTACGGTTACGTAATGA
GAACATAGCACGGTACTTGGCAAACATATCGCCCTCGCGGTCCAATAGAACATCTCGCAGTGCCGCTGTCGACACACTCTTTTCAGCAGCAGGGGCCGGG
TCTTCGGATAAGTACGGATTGCGGTCCACCTCGCTTTCGGTGATGTCGCCATTGGCTTTGGCCAGTTTATACTCAATCAAACTGGCCGCCAACTTGCACG
TATCTGCTACTTCAGGCATCACATCGGTCGTGTACTTCTGAAGTACCGCAAGCGACCGCTGGGCACCAATGGCACCTAGAGCCTCTGCCGCCTCGTGACG
CACCATACCGTCGTCCGTCTCGTCTGCCAGCACGTGCTCCAGCGTGTCGCATGCTTCCGTCATCTGGAACTGACCAATCACGTACGCCAATTCGTGGCGC
ACCAGTTCCGAGTCTTTGCGGTTCAGTAGCGCCGTCAGTAAGACCTCCAGGTCCGTCACTCTACCACGCGACCGCAGGTAGAAGATGGCGCGAGTGCGCT
TGCTCACGGGCTCGGAAAGATCCAGTAAAGCATTGCGTAGCTGCTCGAAGCTCGGCGTCGTTTCGTGCACGGTGGCGATGGGTTCGGACGCTTGCGATGG
CATGTCGGAC