Description :
From Genome Similarity Track
Location :
Scaffold_516:1267- 7132
Sequence
5865 bases(100 bases per row)
TTGTATCGACCAAGGGGTTGGCTTAAGCCATGTATTTATTCACGCTGTGCACTTGCTCATGGGATATTATGGAGACTGCGTACGCTGACGTGGCAACGGC
TCAGTCAAGGCCTGAAAGACAGGATTACTGTCGTGAAAACAGCAACATGAGCCTCTCAAAGTTGGATATAGTCGATCTGATCGATATGAGGCGACTTTTG
TGTACGATGTTGGGACCGCCAGCGTACAGATGGAGTTCTAGTCTGTCGTCGTGGTATAAATTGTGGCGTGAAGCGCATTTAATCAAACAAAGAAAATATA
CTATAAAAAGGCAGNNNNNNNNNNCTTTCTTTTCGTCAGAAAAAATGATCAACATCCATGCACTGGAAAGTATCAGCATCTCCTCCGACCATGCAAGACG
ACGCACACTGTGCATATCCGAAAGATGAAGCGTATTCTCCATTTTTGTGTACGACAGCCAGTCTACATATTGTAGGATACGGCGCACAGTGCGAACCGAG
CACTTCAGCTCGAGCTGATGATGCAGCTGTGTTGCTGAGAAATTTCCGCTTGCTGCCGTGCGAACCAGCACACGAAGAGCCCTATCGGACAGATGTTGTG
GTCTGCTAGTGCTAATGCGACCGACGTGACCGCTCACAACACGCATTACTGCGTCCCGTGACCGATTGACAGCATGCGAGATGACGCGCCCTGTTAGTCC
TGCTTGATGCAATCCCTGAATCCTCCCACGCTCTAGGTCGGTTAGTGCTTCCCCCTTTCCCATCGCTTCAGGAATGCAGAAAAACATTAATATTTCTACT
TGAAATTTGTATGCTTTTTTGGCCGTATACTTTTTGCCGGGCACAAAAAGCGGTTCTTTGTATGTGAGCTATCAGATCGATTCATATTATCGTATTTTAA
CACTGTAGAGGGGTATACTAAAGCTTGGCGCATGTCATACTCAAACGACAGCGTCTAACTCGCATTGGTTATGGAGTTATGAGCACCAATGTGGGTGGCC
CTACCATTATGACCTGGAGTGTATCGCAGTTGTGTCGTTTTACTATCAAGATCACATCCAAACTATTTCTGTCCCTAAATTTAAGCATACAAATACGCGT
TGAGCTGTCTTACGAGGTAGGATATTCGAGTAAACACAATTAAAAGTTTCAATCAAGAAAACGTTAATACTCAATGGATTTCCACCGCTAGTTGCACGCA
ACTTCTCCAGTTTTAACCAATCCCTTACCCTCACTTAGCCCAACGACTCTTCACGCCGTCGTTCACATAGTCATGACGTTGGACCTCGTCATGTACGGCT
CCACGTTGCTGCCGAGCTCCAATCTCTCGTACGTACTCAATGATACTATCGATAGATAAAGTTTGTCGCTTCTTCTATCACAACGATAGTATGATTTCTG
ATGCATGTGCAATCTTCTGGTTTGATAGTGGTCCAGGCGTTGTTTCAACGTGATCCCGTTCATGATCTGCTCGACATTGTATCGACCAAGGGGTTGGCTT
AAGCCATGTATTTATTCACGCTGTGCACTTGCTCATGGGATATTATGGAGACTGCGTACGCTGACGTGGCAACGGCTCAGTCAAGGCCTGAAAGACAGGA
TTACTGTCGTGAAAACAGCAACATGAGCCTCTCAAAGTTGGATATAGTCGATCTGATCGATATGAGGCGACTTTTGTGTACGATGTTGGGACCGCCAGCG
TACAGATGGAGTTCTAGTCTGTCGTCGTGGTATAAATTGTGGCGTGAAGCGCATTTAATCAAACAAAGAAAATATACTATAAAAAGGCAGGTGTGCCTAG
AGTTCGTGTCATTTTTACGAATAGCACGTCTATGAATATATAGTTGTGCAGAAAGGAAGGACTATGCATAATTAATGGATTGCATTTATAGACGCCACGT
GTCGATCCAAGCGGGTCAAGGTAAGATTGACCCAATACGACTTGATCGGACTCGTCTACGTTTAACCGACTCTGGGGCCGCTCTGGAAACGCCTTCAGCT
TTGGACACATGTACCACCGCGAACAACCGATAGGGTGTGCTTGCGACTGCCAATCTCACTGCATGGTCGCCGCATTATTTAGCTACCCGAAATGGTCCAT
AACACATATGAGCTAGCTTTCGAGCGTACCCATCTTTGACGCGATCCAAATATAACCATACTTGTGATTCTTATTTATCTTCAGCAGATCGCGGTTTCGT
TATGACGATCCGCTCGGTCTTGAATCGCGATCTTCAGCCGATCATTCACGACTGCCCTCGCTTGTTGATATTGGCGTTGTATATTATACCTCCATCTTTT
GGGATCGCGATCGCGGGGTTTGACACTTCCTAGTGGTAAGGTCGCTACCGACGCCGATCGAGGGTCCCAGCCATGGATCAAGTAGAACGGCGTTTCTCCG
CGGACTCGATGTTGCGCTGTATTGATCGCATAGGTTAATCGCTCTGCATATTCGTCCGAATCTCTCTGATCTTCATCAGTGACGTACATTTTGATCAATC
GTGTCAGAGTTTGAACCTTGCGTTCTGCGGTTTCGTTCGCTTGAGGTCGATAAGTCATTTTGTCCCGTCGCTTCTGTCCCGCGATTTTGTTGAACGCTCG
GAAGAAATCGGACATAAATCCTGGCTCCTGGTCCTAACGGATGGCTTCAATCTCACCGAATCTTCGAAATACACATTCTTCATACTTTTCTTCGATCGTC
TGTGCAGTTTGTGACGAGCTCGCCTTTGCGATCAGATAGCCTGAGAACAGATCGACCCACAGCAACAACTCTGTATTTCTTTTAACGATCGTGGTAGAGA
CAGAATGTGATTCATGGCCAAAATTTGAAATGGGTAAGTCTCTTGTATGTTTCCTGGCGACCCACCCGATCATGCGGGCAACCCTTGCCGGTTTCACAAT
TGACGCACTCGCCTATATAGCGCTGCACTCTTCTGTACAATCTTCTCCAGTGGAAGTTTATCCTAATCCGTTGATATGTGCGGCCTACTCCTTGGTGCCC
GCCGTCCAACCTAGTATGGTAATGATGTACGACATCTCGTTGCAACAACTCGGGAATTACCAGACGAACCGACTCACCACGATCTTTGCTTTTTGCTGCT
GCCCTAGGACAGGAAAATGAAAGTCCATCTTGGTCGACTTCGTAGTCCGGTGCGATTAGGGAGCATCTTTTTGCCTCTCTAGCATTCAGCATGGCTATAT
CCCCAATCAGATACGCTTTCAAGTCAGATATCCAATTTTCCTCATCTTGCGCCTGATTTATGTGCTCAATCCAGACCTGTTGTACAATTTCTTCTTGCAA
AACGGCCGGGTAACATCGTCTTCGCGTCGTTGACCGCATGATAGTACCTTGACTGGGGGGCAGGCTTGTCTCGGTATCAGTAACTCATTCAACCGATTAA
GCATCATGAGATTGTTTTGTTCCTGGTCTGATACCACGGCGCCCCTCTTCTCCTGCTGTAGAGCTTCGCTCGCTAGCTGATCAGCACTCTGGTTCCAGTC
CCGTTTCATATGTAGAAATTCGTGCTTTGGCCATGATCGGAGTTTCTCCATTGCCATATACCGCAGCAATTGCAAAACTGGTGCCTTACAATCAATTTCG
CCCCGCATCTGTCTGATCACCAAGTTCGAGTCACCACAAAAGATCGCCCACCCCTTAGCCTGATCAGCCAGTAAATCAAACCAAGCAATAGCCCACGGTA
TTCCGCTTCATTTATTGTCAAATTCTCTGCAAACTCGGAAATAGCAGCCACGATCGTCCACTCAGGTAACTTCCATAAATATCGCACTGTAGGCGACGCC
CTTGTTCTTTACCCTAGCCGATCCATCAAAAATGAACACCAGGACGGGTTCGTCTGCTTCGACCGTGGGTGGTAGTATGCTTATGGTTTGCCGTGGCTGT
TTTCTTGGATCAATCGCGATCAGGACTTCGTCTACGTCTTTGCGGGGTGTCACACTTGCGGTTAGCATACCCAGCATTTCGTCTTCGCCTTTTTCACATC
GTCGGATATCTAAATTCCAGTTTGATAGCAGCGACGCCCATATCCCTAATCTTCCGTTGAGACTAGACGACTGCAACAGCCAAGCCAACGTTGAATATCT
CATAAGTACTATAAACTCTCGTGAAACCAACATCGTAAGCCAAATGTCTAATATTCGGAGGAGAGCTAACACCTCTTTCTTGACCGTTCCATAATTGACT
TCATTGGACTTCAGCTTGCGGCTAGAAAAGGTGACTGGCCAATATATTCCGTCGTATTCCTGGAGCAATGCAGCTGATACCACGCACTTACTGACGTATA
CCACAATCACAGGCGCTTGATTTGGATTGAAATGTCTTAAGATTGGGGTTATAGCAATTTTAGCCTATAACAGAGTAAAATCTATTACCGCTTTCTTCCA
TCAACTTCTGTTTCCGAACTCCGGATCGCCCCCAACATTTTGGTCCAGATCACCCCCTGTATTTGAGCCAGGAATGTGTTCGGACCCATCTCGTGAATCG
TGAATCGCGATCTCGATCTGATTCGGTGTCTGATACAAATAGCTGAACATATTTGTCTCGGCTGATCTCATAAAAATCCGTTTCCCGCAGCTCATAGAGC
ACAGAAGCATATATCGCAAAGTCTTCAATGAAGCGACTGTAGTAATTTAGGATTCCCAAGAATGACTGCATTGATCGCAGAGTTCGAGGAAAGGGAATAT
TCATAATTGAATCTTAATCCGTGGAGTGGGCTTCCATTTCCTCGAGCAAAACTTGATGGCTTTTGTAGTCGACCTTGCGACGCCCCTAGAAAATTTTGGC
TACACTGATCGATAAGTTTCATCTATCACACACTTCCAACAGCCGTTCCACCCTTTCATATAGGGAAGTCCATGACGTAGCAGGTATCAAGATGTCGTCG
GTATACGATCTTCGACCTAGGACCGACGGTCTAGGGTTTGTATCCAGCACTCCGTCAGTGAACACATCGGTTAGCGTAGATGAAGGTGTTGTACTCGAGT
TAGATTTTGGGCCGATCTTCAGATACCCATATAGTGCAATTTCGATCAGTTGCTGGTAGATCTGGGGAGCGTTTTTCAACCCAAAAGGCATTCGTAAACA
TTCAAACAAACCCGAAGGTGTGACGAAAGCGTAAATAGCTTTTGCTCGTTCTGTCATCTCCACCACCCAAAATTCACTCGCCATATTCAAAGAGCAATAC
CACATCGCTTTATCCAGGTCTTGCAGTAATTCGCTAACCAGTGGCATGGGATATATTATCAATCTTGTCAACTAGTTCACCTTTCTGTAATCAATGCATA
GTCGTATATCTTCCCCATCTTTCTTGATGATCGCCACAATAGGGGAAGCCCAAGGTGAGGTGGATGGTTGAATGATCTTGGCCGATAGTAGTCCCTTGAT
CAGATCTGCCAGTTTCTCTGGATATTTGGGTTCCACTGTCCGTACTCTCTGCGCTATCGGTTTAGCACTGCTGACATCAATATCGCATACCACTCCACGC
GCAGCTGGAGGCAGGGCATTCCTCTTCCCTATGAGTAAATGGCGATTCTTCCAGATCAGTTGTTGCAACTTCTCTTGATCATCTGTCAGTGGTTTACCTG
GGTCGCAGAATTGGATGTCTTCGATAGCCACCTCTACCGTGGGAGCGACTATTTCTGGCAAGATTGCCATATGTTGGTCCACGTTTCGGCGAATAGGTCA
ACCGTGTCATGGCGATATACCGCAGTTTTCGTCGGATTGTTATCTGCTGAGTCTTCTTCGTTCGTGGGCGTTGTAGCGCTTTTACTCCCTTAATCTGACA
GTTTTGATCCTGATCGTCCTCATCCCAGCAATCATTCTCGATCGCGACCACCTTTGCTTGTACGA