Description :
From Genome Similarity Track
Location :
Scaffold_209:126677- 128114
Sequence
1437 bases(100 bases per row)
TGGTATGTCCGACCAATTCCTTGATGTCCACCTTTTAGACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCAACACCAGTCTCATCA
ATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTT
AGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCACTCAATG
CGGATCCCCTTCACAAATGTTTCCTCGAGAATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGTCATCACCTGGACTGTCCTTTTCCCGG
GTCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTTGACACCACATTGATTCCGTAAAGCGGC
ACTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAAC
AGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCATCAGCCTTTTTGGATCTTGTCCCT
TTAGTAGATCCAAACCCAACAGGAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCTTACAACTTCCCATCCGGG
CAGTCTCCACAATATTGCGCTGTATGCTCCTCCTCCGCGTACGACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTGCATGTACCGTC
CGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCAAGGTGTGATGCTCGCGGCCAAGA
CTCCCAGGATCTCGTCTCCCCCTTTCGAAAATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGC
CGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCG
AGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGTTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCA
GAGCTGCTGAGACTGCCCAGTCACTAGCATAGACTATCACCGTAGGTTCACGTTCCGGATCGAAATGGCGGAGGATGGGCGTCGTCGCGATCCTGTTCCT
TAGCACCACGAACGCGCGCTGAGCTCGGATCCACCGA